Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD8b

BD™ AbSeq Oligo Rat Anti-Mouse CD8b

Clone H35-17.2 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ly-3; Lyt-3; Lymphocyte antigen 3; Ly-C; CD8b1
12526
2 µl
Rat IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTCGGGCGGTTATAGTATTAGTTGAGTCCAGCATC
AMM2189
5-day MLR, C57BL/6 anti-BALB/c
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940360 Rev. 2
Antibody Details
Down Arrow Up Arrow
H35-17.2

The H35-17.2 monoclonal antibody specifically binds to both alloantigeneic forms of the β chain of the CD8 differentiation antigen (Ly-3 or Lyt- 3).  The CD8 α and α' chains (CD8a) form heterodimers with the CD8 β chain (CD8b, Ly-3, or Lyt-3) on the surface of most thymocytes.  A subpopulation of mature T lymphocytes (i.e., MHC class I-restricted T cells, including most T suppressor/cytotoxic cells) expresses almost exclusively the CD8 αβ heterodimer (the α' chain is absent).  Subsets of γδ TCR-bearing T cells, intestinal intraepithelial lymphocytes, and dendritic cells express CD8a without CD8b. It has been suggested that the expression of the CD8a/CD8b heterodimer is restricted to T lymphocytes which matured in the thymus or in an extrathymic environment that had been influenced by thymus- initiated neuroendocrine signals.  CD8 is an antigen coreceptor on the T-cell surface which interacts with MHC class I molecules on antigen-presenting cells. It participates in T-cell activation through its association with the T-cell receptor complex and protein tyrosine kinase lck (p56lck). The H35-17.2 mAb blocks T-cell-mediated cytolysis of allogeneic lymphoma cells.

940360 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940360 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940360" on CiteAb

Development References (20)

  1. Bierer BE, Sleckman BP, Ratnofsky SE, Burakoff SJ. The biologic roles of CD2, CD4, and CD8 in T-cell activation. Annu Rev Immunol. 1989; 7:579-599. (Biology). View Reference
  2. Fujiura Y, Kawaguchi M, Kondo Y, et al. Development of CD8 alpha alpha+ intestinal intraepithelial T cells in beta 2-microglobulin- and/or TAP1-deficient mice. J Immunol. 1996; 156(8):2710-2715. (Biology). View Reference
  3. Golstein P, Goridis C, Schmitt-Verhulst AM . Lymphoid cell surface interaction structures detected using cytolysis-inhibiting monoclonal antibodies. Immunol Rev. 1982; 68:5-42. (Immunogen: Cytotoxicity, Immunoprecipitation, Inhibition). View Reference
  4. Janeway CA Jr. The T cell receptor as a multicomponent signalling machine: CD4/CD8 coreceptors and CD45 in T cell activation. Annu Rev Immunol. 1992; 10:645-674. (Biology). View Reference
  5. LeFrancois L. Extrathymic differentiation of intraepithelial lymphocytes: generation of a separate and unequal T-cell repertoire. Immunol Today. 1991; 12(12):436-438. (Biology). View Reference
  6. Ledbetter JA, Rouse RV, Micklem HS, Herzenberg LA. T cell subsets defined by expression of Lyt-1,2,3 and Thy-1 antigens. Two-parameter immunofluorescence and cytotoxicity analysis with monoclonal antibodies modifies current views. J Exp Med. 1980; 152(2):280-295. (Biology). View Reference
  7. Ledbetter JA, Seaman WE, Tsu TT, Herzenberg LA. Lyt-2 and Lyt-3 antigens are on two different polypeptide subunits linked by disulfide bonds. Relationship of subunits to T cell cytolytic activity. J Exp Med. 1981; 153:1503-1516. (Biology).
  8. Lefrancois L. Phenotypic complexity of intraepithelial lymphocytes of the small intestine. J Immunol. 1991; 147(6):1746-1751. (Biology). View Reference
  9. MacDonald HR, Schreyer M, Howe RC, Bron C. Selective expression of CD8 alpha (Ly-2) subunit on activated thymic gamma/delta cells. Eur J Immunol. 1990; 20(4):927-930. (Biology). View Reference
  10. Murosaki S, Yoshikai Y, Ishida A, et al. Failure of T cell receptor V beta negative selection in murine intestinal intra-epithelial lymphocytes. Int Immunol. 1991; 3(10):1005-1013. (Biology). View Reference
  11. Nakayama K, Nakayama K, Negishi I, et al. Requirement for CD8 beta chain in positive selection of CD8-lineage T cells. Science. 1994; 263(5150):1131-1133. (Biology). View Reference
  12. O'Rourke AM, Mescher MF. The roles of CD8 in cytotoxic T lymphocyte function. Immunol Today. 1993; 14(4):183-188. (Biology). View Reference
  13. Rocha B, Vassalli P, Guy-Grand D. The extrathymic T-cell development pathway. Immunol Today. 1992; 14(3):140-141. (Biology). View Reference
  14. Sydora BC, Brossay L, Hagenbaugh A, Kronenberg M, Cheroutre H. TAP-independent selection of CD8+ intestinal intraepithelial lymphocytes. J Immunol. 1996; 156(11):4209-4216. (Biology). View Reference
  15. Süss G, Shortman K. A subclass of dendritic cells kills CD4 T cells via Fas/Fas-ligand-induced apoptosis. J Exp Med. 1996; 183(4):1789-1796. (Biology). View Reference
  16. Vremec D, Zorbas M, Scollay R, et al. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J Exp Med. 1992; 176(1):47-58. (Biology). View Reference
  17. Walker ID, Murray BJ, Hogarth PM, Kelso A, McKenzie IF. Comparison of thymic and peripheral T cell Ly-2/3 antigens. Eur J Immunol. 1984; 14(10):906-910. (Biology). View Reference
  18. Wang J, Klein JR. Thymus-neuroendocrine interactions in extrathymic T cell development. Science. 1994; 265(5180):1860-1862. (Biology). View Reference
  19. Wu L, Vremec D, Ardavin C, et al. Mouse thymus dendritic cells: kinetics of development and changes in surface markers during maturation. Eur J Immunol. 1995; 25(2):418-425. (Biology). View Reference
  20. Zamoyska R. The CD8 coreceptor revisited: one chain good, two chains better. Immunity. 1994; 1(4):243-246. (Biology). View Reference
View All (20) View Less
940360 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.