Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD88

BD™ AbSeq Oligo Rat Anti-Mouse CD88

Clone 20/70 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd88; C5ar1; C5a-R; C5aR; C5r1; C5a Ligand; C5a anaphylatoxin receptor
12273
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGATTCGGTGGTCTGATTAGGAGGTAGTAGCGTTGT
AMM2198
Mouse C5aR Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940438 Rev. 2
Antibody Details
Down Arrow Up Arrow
20/70

The 20/70 monoclonal antibody specifically binds to CD88, which is also known as, Complement component 5a receptor 1 (C5ar1), C5a anaphylatoxin chemotactic receptor, or C5a receptor (C5aR). CD88 belongs to the rhodopsin family of seven-transmembrane G protein-coupled receptors and mediates its effects by binding to the complement activation product, C5a. CD88 is expressed on leucocytes including, neutrophils, monocytes, macrophages, and eosinophils. CD88 may also be expressed on alveolar epithelial cells, endothelial cells, neural stem cells, oligodendrocytes, and on parenchymal cells of lung, liver, kidney and heart. Binding of the proinflammatory C5a anaphylatoxin to CD88 results in G-protein coupling and intracellular signal transduction that mediates intracellular calcium release, chemotaxis, degranulation, cytokine production, and superoxide anion production. The 20/70 antibody can block binding of C5a to CD88 and thus inhibit its biological functions.

940438 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940438 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940438" on CiteAb

Development References (6)

  1. Godau J, Heller T, Hawlisch H, et al. C5a initiates the inflammatory cascade in immune complex peritonitis.. J Immunol. 2004; 173(5):3437-45. (Clone-specific: Blocking, Flow cytometry, Inhibition, In vivo exacerbation). View Reference
  2. Laudes IJ, Chu JC, Huber-Lang M, et al. Expression and function of C5a receptor in mouse microvascular endothelial cells. J Immunol. 2002; 169(10):5962-5970. (Biology). View Reference
  3. Lee H, Whitfeld PL, Mackay CR. Receptors for complement C5a. The importance of C5aR and the enigmatic role of C5L2. Immunol Cell Biol. 2008; 86(2):153-160. (Biology). View Reference
  4. Nataf S, Levison SW, Barnum SR. Expression of the anaphylatoxin C5a receptor in the oligodendrocyte lineage. Brain Res. 2001; 894(2):321-326. (Biology). View Reference
  5. Riedemann NC, Guo RF, Neff TA, et al. Increased C5a receptor expression in sepsis. J Clin Invest. 2002; 110(1):101-108. (Biology). View Reference
  6. Soruri A, Kim S, Kiafard Z, Zwirner J. Characterization of C5aR expression on murine myeloid and lymphoid cells by the use of a novel monoclonal antibody. Immunol Lett. 2003; 88(1):47-52. (Immunogen: Blocking, Flow cytometry, Functional assay, Inhibition). View Reference
View All (6) View Less
940438 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.