Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD84

BD™ AbSeq Oligo Rat Anti-Mouse CD84

Clone 1D3/CD84

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd84; CDw84; SLAM family member 5; SLAMF5
12523
2 µl
Rat IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGTGTTGGCGCGGTAATTTAAGAGTCGATGGAAGT
AMM2237
Mouse CD84 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940475 Rev. 2
Antibody Details
Down Arrow Up Arrow
1D3/CD84

The 1D3/CD84 monoclonal antibody specifically recognizes CD84 which is also known as Signaling lymphocytic activation molecule 5 (SLAM family member 5 or Slamf5). CD84 is a single-pass type I transmembrane glycoprotein that is encoded by Cd84 (CD84 antigen) which belongs to the SLAM family within the CD2-subset of the immunoglobulin superfamily (IgSF) of cell surface receptors. CD84 is comprised of an extracellular region with one N-terminal Ig-like V-type (IgV) domain followed by one Ig-like C2-type (IgC2) domain. Its cytoplasmic tail contains two immunoreceptor tyrosine-based switch motifs (ITSMs) and serves as a docking site for activating adaptor molecules, SLAM-associated protein (SAP) or EWS-activated transcript 2 (EAT-2), or inhibitory SH2-binding phosphatases. CD84 is variably expressed on B cells, T cells, NK cells, monocytes, macrophages, dendritic cells, granulocytes, mast cells, hematopoietic progenitor cells, and platelets. CD84 is a homotypic adhesion molecule that can function as a coreceptor in the regulation of innate and adaptive immune responses including the enhancement of T cell proliferation and cytokine production.

940475 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940475 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (2)

  1. Cruz-Munoz ME, Dong Z, Shi X, Zhang S, Veillette A. Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2, on natural killer cell function.. Nat Immunol. 2009; 10(3):297-305. (Clone-specific). View Reference
  2. Guo H, Cruz-Munoz ME, Wu N, Robbins M, Veillette A. Immune cell inhibition by SLAMF7 is mediated by a mechanism requiring src kinases, CD45, and SHIP-1 that is defective in multiple myeloma cells.. Mol Cell Biol. 2015; 35(1):41-51. (Clone-specific). View Reference
940475 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.