Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD49d

BD™ AbSeq Oligo Rat Anti-Mouse CD49d

Clone R1-2 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Integrin α4; Itga4; Integrin alpha-4; LPAM alpha; VLA-4 alpha; VLA-4a
16401
2 µl
Rat F344, also known as Fischer, CDF IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGCGCGTTTGAGAGTCGGGATATTTCGTTAGGTTCG
AMM2075
AKR/Cum mouse spontaneous T lymphoma line TK1
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940179 Rev. 2
Antibody Details
Down Arrow Up Arrow
R1-2

The R1-2 monoclonal antibody specifically binds to α4 chain (CD49d), which is expressed as a heterdimer with either of two β, β1 or β7 (also known as βp). The α4β1 integrin (VLA-4, CD49d/CD29) is expressed on most peripheral lymphocytes, thymocytes, and monocytes; while the α4β7 integrin (LPAM-1) is expressed on peripheral lymphocytes, but on only a small subset of thymocytes. These integrins mediate a variety of cell-cell and cell-matrix interactions, recognizing the ligands VCAM-1 (CD106) and fibronectin. There is evidence that levels of VLA-4 expression regulate the transendothelial migration of T lymphocytes into inflamed tissues. Integrin α4β7 also preferentially binds to the mucosal vascular addressin, MAdCAM-1. The R1-2 antibody blocks some α4 integrin-mediated binding functions. In combination with mAb 9C10 (MFR4.B) (Cat. No. 553313), binding of VLA-4 expressing cells to VCAM-1 can be almost completely inhibited.  

940179 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940179 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940179" on CiteAb

Development References (8)

  1. Andrew DP, Berlin C, Honda S, et al. Distinct but overlapping epitopes are involved in alpha 4 beta 7-mediated adhesion to vascular cell adhesion molecule-1, mucosal addressin-1, fibronectin, and lymphocyte aggregation. J Immunol. 1994; 153(9):3847-3861. (Biology). View Reference
  2. Berlin C, Berg EL, Briskin MJ, et al. Alpha 4 beta 7 integrin mediates lymphocyte binding to the mucosal vascular addressin MAdCAM-1. Cell. 1993; 74(1):185-195. (Biology). View Reference
  3. Ferguson TA, Kupper TS. Antigen-independent processes in antigen-specific immunity. A role for alpha 4 integrin. J Immunol. 1993; 150(4):1172-1182. (Biology). View Reference
  4. Holzmann B, McIntyre BW, Weissman IL. Identification of a murine Peyer's patch--specific lymphocyte homing receptor as an integrin molecule with an alpha chain homologous to human VLA-4 alpha. Cell. 1989; 56(1):37-46. (Immunogen). View Reference
  5. Holzmann B, Weissman IL. Peyer's patch-specific lymphocyte homing receptors consist of a VLA-4-like alpha chain associated with either of two integrin beta chains, one of which is novel. EMBO J. 1989; 8(6):1735-1741. (Clone-specific: Immunoprecipitation, Inhibition). View Reference
  6. Kilshaw PJ, Murant SJ. Expression and regulation of beta 7(beta p) integrins on mouse lymphocytes: relevance to the mucosal immune system. Eur J Immunol. 1991; 21(10):2591-2597. (Biology). View Reference
  7. Kinashi T, Springer TA. Adhesion molecules in hematopoietic cells. Blood Cells. 1994; 20(1):25-44. (Biology). View Reference
  8. Romanic AM, Graesser D, Baron JL, Visintin I, Janeway CA Jr, Madri JA. T cell adhesion to endothelial cells and extracellular matrix is modulated upon transendothelial cell migration. Lab Invest. 1997; 76(1):11-23. (Biology). View Reference
View All (8) View Less
940179 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.