Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD335 (NKp46)

BD™ AbSeq Oligo Rat Anti-Mouse CD335 (NKp46)

Clone 29A1.4

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ncr1; NK-p46; NKp46; mNKp46; MAR1; mAR-1; mouse activating receptor 1; Ly94
17086
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGGTGGTTGAGTAATTAGACGTAGGGTGCGAGTTG
AMM2036
Mouse NKP46 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940140 Rev. 2
Antibody Details
Down Arrow Up Arrow
29A1.4

The monoclonal antibody 29A1.4 specifically binds to mouse CD335, also known as NKp46. NKp46 is a 46 kDa type I transmembrane glycoprotein that is a member of the natural cytotoxicity receptor (NCR) family and immunoglobulin superfamily. NKp46 is encoded by the Ncr1 gene located on chromosome 7. NKp46 functions as a cytotoxicity triggering receptor and is selectively expressed by immature and mature NK cells in all mouse strains tested. NKp46 is detected on a minute fraction of NK-like T cells (less than 2% of NKp46+ express CD3e) but not on CD1d-restricted NKT cells from C57BL/6 mice. When immobilized on tissue culture plates, the 29A1.4 antibody reportedly stimulates NK cells to produce interferon-gamma and to release their cytoplasmic granule contents. Although the ligands for the NKp46 receptor have not been fully characterized, recent evidence indicates that this receptor plays an important role in the NK cell-mediated recognition and killing of some virus-infected cells and tumor cells. The immunogen used to generate the 29A1.4 clone was mouse NKp46-Fc recombinant protein.

940140 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940140 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Biassoni R, Pessino A, Bottino C, Pende D, Moretta L, Moretta A. The murine homologue of the human NKp46, a triggering receptor involved in the induction of natural cytotoxicity. Eur J Immunol. 1999; 29(3):1014-1020. (Biology). View Reference
  2. Gazit R, Gruda R, Elboim M, et al. Lethal influenza infection in the absence of the natural killer cell receptor gene Ncr1. Nat Immunol. 2006; 7(5):517-523. (Biology). View Reference
  3. Joncker NT, Fernandez NC, Treiner E, Vivier E, Raulet DH. NK cell responsiveness is tuned commensurate with the number of inhibitory receptors for self-MHC class I: the rheostat model. J Immunol. 2009; 182(8):4572-4580. (Clone-specific: Flow cytometry). View Reference
  4. Walzer T, Blery M, Chaix J, et al. Identification, activation, and selective in vivo ablation of mouse NK cells via NKp46. Proc Natl Acad Sci U S A. 2007; 104(9):3384-3389. (Immunogen: Activation, Flow cytometry). View Reference
940140 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.