Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD276

BD™ AbSeq Oligo Rat Anti-Mouse CD276

Clone MIH32 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd276; B7-H3; B7 homolog 3; B7h3; B7RP-2; Costimulatory molecule
102657
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGACACAAAGAATTCGGACGTATATGATGCTAGGCG
AMM2225
Mouse B7-H3 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940499 Rev. 2
Antibody Details
Down Arrow Up Arrow
MIH32

The MIH32 monoclonal antibody specifically binds to CD276, also known as B7-H3 (B7 homolog 3). CD276 is a type I transmembrane glycoprotein and member of the B7-family of regulatory proteins. The expression of B7-H3 can be induced on T cells, natural killer (NK) cells and antigen presenting cells. B7-H3 is up-regulated during the differentiation of monocytes into dendritic cells or during the interaction between dendritic cells and regulatory T cells. In addition, B7-H3 is found to be expressed on fibroblasts, fibroblast-like synoviocytes and epithelial cells. CD276 (B7-H3) can function as a positive or a negative regulator of T responses.

940499 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940499 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940499" on CiteAb

Development References (3)

  1. Chapoval AI, Ni J, Lau JS, et al. B7-H3: a costimulatory molecule for T cell activation and IFN-gamma production. Nat Immunol. 2001; 2(3):269-274. (Biology). View Reference
  2. Hashiguchi M, Kobori H, Ritprajak P, Kamimura Y, Kozono H, Azuma M. Triggering receptor expressed on myeloid cell-like transcript 2 (TLT-2) is a counter-receptor for B7-H3 and enhances T cell responses. Proc Natl Acad Sci U S A. 2008; 105(30):10495-10500. (Immunogen: Flow cytometry). View Reference
  3. Sun M, Richards S, Prasad DV, Mai XM, Rudensky A, Dong C. Characterization of mouse and human B7-H3 genes. J Immunol. 2002; 168(12):6294-6297. (Biology). View Reference
940499 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.