Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD274

BD™ AbSeq Oligo Rat Anti-Mouse CD274

Clone MIH5

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
B7-H1, PD-L1; PD1L1; Programmed death ligand 1
60533
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2a, λ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ACATGAGAGTAGGTTAATTGGTCGAGCAGTATAGTC
AMM2038
DBA/2 mouse lymphoma L5178Y transfected with Pdcd1lg1 cDNA
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940142 Rev. 3
Antibody Details
Down Arrow Up Arrow
MIH5

The MIH5 monoclonal antibody specifically binds to CD274, also known as B7-H1 or PDL1, a 43-kDa glycoprotein encoded by the Pdcd1lg1 gene of the B7 family of the Ig superfamily. Pdcd1lg1 mRNA is expressed in more tissues than other members of the B7 family; transcripts are found in lymphoid tissues and many, but not all, non-lymphoid tissues. The protein has been detected at low levels on resting peripheral T and B lymphocytes, macrophages, and dendritic cells. B7-H1 mRNA and protein expression are upregulated upon activation of T and B cells, macrophages, dendritic cells, and epidermal keratinocytes by a variety of stimulatory factors. B7-H1's receptor, PD-1, contains an ITIM (Immunoreceptor Tyrosine-based Inhibitory Motif) on its intracytoplasmic region and is expressed on activated B and T lymphocytes, suggesting that B7-H1-PD-1 interaction may be involved in the negative regulation of immune responses. The second PD-1 ligand, B7-DC (PD-L2), is also a member of the B7 family of the Ig superfamily. Furthermore, B7-H1 may participate in positive immunoregulation, or costimulation of T cells, through an additional receptor, which is not PD-1 and distinct from the alternate receptor for B7-DC. The MIH5 antibody blocks the binding of PD-1-Ig to B7-H1 transfectants.

940142 Rev. 3
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940142 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (9)

  1. Ansari MJ, Salama AD, Chitnis T, et al. The programmed death-1 (PD-1) pathway regulates autoimmune diabetes in nonobese diabetic (NOD) mice. J Exp Med. 2003 July; 198(1):63-69. (Biology). View Reference
  2. Carreno BM, Collins M. The B7 family of ligands and its receptors: New pathways for costimulation and inhibition of immune responses. Annu Rev Immunol. 2002; 20:29-53. (Biology). View Reference
  3. Dong H, Chen L. B7-H1 pathway and its role in the evasion of tumor immunity. J Mol Med. 2003 May; 81(5):281-287. (Clone-specific). View Reference
  4. Hessel EM, Chu M, Lizcano JO, et al. Immunostimulatory oligonucleotides block allergic airway inflammation by inhibiting Th2 cell activation and IgE-mediated cytokine induction. J Exp Med. 2005; 202(11):1563-1573. (Clone-specific: Flow cytometry). View Reference
  5. Liu X, Gao JX, Wen J, et al. B7DC/PDL2 promotes tumor immunity by a PD-1-independent mechanism. J Exp Med. 2003; 197:1721-1730. (Biology). View Reference
  6. Tamura H, Dong H, Zhu G, et al. B7-H1 costimulation preferentially enhances CD28-independent T-helper cell function. Blood. 2001; 97(6):1809-1816. (Biology). View Reference
  7. Tsushima F, Iwai H, Otsuki N, et al. Preferential contribution of B7-H1 to programmed death-1-mediated regulation of hapten-specific allergic inflammatory responses. Eur J Immunol. 2003; 33(10):2773-2782. (Immunogen: Blocking, Enhancement, Functional assay, Immunofluorescence, Immunohistochemistry, Inhibition, In vivo exacerbation). View Reference
  8. Wang S, Bajorath J, Flies DB, Dong H, Honjo T, Chen L. Molecular modeling and functional mapping of B7-H1 and B7-DC uncouple costimulatory function from PD-1 interaction. J Exp Med. 2003; 197:1083-1091. (Biology). View Reference
  9. Yamazaki T, Akiba H, Iwai H, et al. Expression of programmed death 1 ligands by murine T cells and APC. J Immunol. 2002; 169(10):5538-5545. (Biology). View Reference
View All (9) View Less
940142 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.