Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD25

BD™ AbSeq Oligo Rat Anti-Mouse CD25

Clone 3C7

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Interleukin-2 receptor alpha chain; IL-2RA; IL-2Rα; Il2ra; IL-2R p55
16184
2 µl
Rat LEW, also known as Lewis IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGATTATAAGTGACGGGAAGTAGACGCGGAGTAGT
AMM2164
IL-2-dependent BALB/c mouse cell line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940356 Rev. 2
Antibody Details
Down Arrow Up Arrow
3C7

The 3C7 monoclonal antibody specifically binds to CD25, the low affinity IL-2 Receptor (IL-2Rα, p55) expressed on activated T and B lymphocytes from all mouse strains tested. IL-2Rα by itself is not a signaling receptor. However, it can combine with IL-2 Receptor β (CD122) and γc (CD132) chains to form high-affinity signaling receptor complexes for IL-2. Resting T and B lymphocytes as well as resting and activated NK cells do not express IL-2Rα. CD25 is transiently expressed at a low level during normal B-cell development in the bone marrow during the CD45R/B220low TdT- sIg- Pre-B/Pre-B-II and CD45R/B220low TdT- sIgM+ sIgD- immature B stages, but not during the CD45R/B220low TdT+ sIg- Pro-B/Pre B-I stage nor on CD45R/B220high TdTsIgM+ sIgD+ mature B cells. It is expressed at a higher level during a very early stage of T-cell development in fetal and adult thymus. Peripheral CD25+ CD4+ T lymphocytes called regulatory T (Treg) cells are involved in the maintenance of self-tolerance. It has also been reported that dendritic cells express CD25 (recognized by mAb 7D4, another CD25-specific antibody). The 3C7 antibody recognizes an epitope of CD25 which is distinct from those recognized by the other CD25-specific mAbs, 7D4 and PC61. 3C7 blocks the binding of IL-2 to CD25.

940356 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940356 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (12)

  1. Chen J, Ma A, Young F, Alt FW. IL-2 receptor alpha chain expression during early B lymphocyte differentiation. Int Immunol. 1994; 6(8):1265-1268. (Clone-specific: Flow cytometry). View Reference
  2. Crowley M, Inaba K, Witmer-Pack M, Steinman RM. The cell surface of mouse dendritic cells: FACS analyses of dendritic cells from different tissues including thymus. Cell Immunol. 1989; 118(1):108-125. (Biology). View Reference
  3. Garni-Wagner BA, Witte PL, Tutt MM, et al. Natural killer cells in the thymus. Studies in mice with severe combined immune deficiency. J Immunol. 1990; 144(3):796-803. (Biology). View Reference
  4. Habu S, Okumura K, Diamantstein T, Shevach EM. Expression of interleukin 2 receptor on murine fetal thymocytes. Eur J Immunol. 1985; 15(5):456-460. (Biology). View Reference
  5. Malek TR, Robb RJ, Shevach EM. Identification and initial characterization of a rat monoclonal antibody reactive with the murine interleukin 2 receptor-ligand complex. Proc Natl Acad Sci U S A. 1983; 80(18):5694-5698. (Biology). View Reference
  6. Malek TR. The biology of interleukin-2. Annu Rev Immunol. 2008; 26:453-479. (Biology). View Reference
  7. Moreau JL, Nabholz M, Diamantstein T, Malek T, Shevach E, Theze J. Monoclonal antibodies identify three epitope clusters on the mouse p55 subunit of the interleukin 2 receptor: relationship to the interleukin 2-binding site. Eur J Immunol. 1987; 17(7):929-935. (Clone-specific: Bioassay, Blocking, Functional assay, Inhibition, Neutralization, Radioimmunoassay). View Reference
  8. Ortega G, Robb RJ, Shevach EM, Malek TR. The murine IL 2 receptor. I. Monoclonal antibodies that define distinct functional epitopes on activated T cells and react with activated B cells. J Immunol. 1984; 133(4):1970-1975. (Immunogen: Blocking, Flow cytometry, Immunoprecipitation, Inhibition, Neutralization, Radioimmunoassay). View Reference
  9. Pollard AM, Lipscomb MF. Characterization of murine lung dendritic cells: similarities to Langerhans cells and thymic dendritic cells. J Exp Med. 1990; 172(1):159-167. (Biology). View Reference
  10. Read S, Malmstrom V, Powrie F. Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25(+)CD4(+) regulatory cells that control intestinal inflammation. J Exp Med. 2000; 192(2):295-302. (Biology). View Reference
  11. Rolink A, Grawunder U, Winkler TH, Karasuyama H, Melchers F. IL-2 receptor alpha chain (CD25, TAC) expression defines a crucial stage in pre-B cell development. Int Immunol. 1994; 6(8):1257-1264. (Biology). View Reference
  12. Takahashi T, Tagami T, Yamazaki S, et al. Immunologic self-tolerance maintained by CD25(+)CD4(+) regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med. 2000; 192(2):303-309. (Biology). View Reference
View All (12) View Less
940356 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.