Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD179a

BD™ AbSeq Oligo Rat Anti-Mouse CD179a

Clone R3/VpreB

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
VpreB
22362
2 µl
Rat CD, also known as Charles River SD (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAAGTAGTGTTGGATTAGGCGGGTCAGTTGTCGTTG
AMM2219
Recombinant mouse VpreB protein and mouse pre-B lymphoma 70Z/3
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940443 Rev. 2
Antibody Details
Down Arrow Up Arrow
R3/VpreB

The pre-B cell receptor (pre-BCR) expressed during the early stages of B lymphocyte development is a heterodimer of immunoglobulin heavy chain (IgH) with surrogate light chain, which is an Ig-light-chain-like molecule composed of the non-covalently linked CD179b (λ5) and CD179a (VpreB) proteins. The pre-BCR is believed to control IgH repertoire selection and proliferation of differentiating B lymphocytes. The R3/VpreB antibody reacts with CD179a and pre-BCR in pre-B-cell lines, but not CD179b alone. It detects pre-BCR on the surface of early B-lineage cell lines. R3/VpreB antibody has been reported to detect both cell-surface and intracytoplasmic surrogate light chain in normal bone marrow. However, in CD179b-deficient (λ5[-/-]) bone marrow, R3 antibody can detect only intracytoplasmic CD179a. At the earliest stages of B chain associates with a complex of glycoproteins, including a nonclassical cadherin, which could be involved in selective adhesion events during B-lymphocyte development.

940443 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940443 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Martensson IL, Ceredig R. Review article: role of the surrogate light chain and the pre-B-cell receptor in mouse B-cell development. Immunology. 2000; 101(4):435-441. (Biology). View Reference
  2. Melchers F, ten Boekel E, Seidl T, et al. Repertoire selection by pre-B-cell receptors and B-cell receptors, and genetic control of B-cell development from immature to mature B cells. Immunol Rev. 2000; 175:33-46. (Biology). View Reference
  3. Ohnishi K, Shimizu T, Karasuyama H, Melchers F. The identification of a nonclassical cadherin expressed during B cell development and its interaction with surrogate light chain. J Biol Chem. 2000; 275(40):31134-31144. (Biology). View Reference
  4. Shimizu T, Mundt C, Licence S, Melchers F, Martensson IL. VpreB1/VpreB2/lambda 5 triple-deficient mice show impaired B cell development but functional allelic exclusion of the IgH locus. J Immunol. 2002; 168(12):6286-6293. (Biology). View Reference
  5. Stephan RP, Elgavish E, Karasuyama H, Kubagawa H, Cooper MD. Analysis of VpreB expression during B lineage differentiation in lambda5-deficient mice. J Immunol. 2001; 167(7):3734-3739. (Immunogen: ELISA, Flow cytometry, Immunoprecipitation, Western blot). View Reference
  6. Wang YH, Stephan RP, Scheffold A, et al. Differential surrogate light chain expression governs B-cell differentiation. Blood. 2002; 99(7):2459-2467. (Clone-specific: Flow cytometry). View Reference
View All (6) View Less
940443 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.