Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD122

BD™ AbSeq Oligo Rat Anti-Mouse CD122

Clone TM-β1 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Il2rb; Il-2Rbeta; IL-2Rβ; IL-15Rbeta; IL-2/15 Receptor-beta; IL-2/15Rbeta
16185
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGGTGATGAGTTCGGTTAGCGGTTGCGGGTTATGT
AMM2069
Mouse IL-2Rβ Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940173 Rev. 2
Antibody Details
Down Arrow Up Arrow
TM-β1

The TM-β1 monoclonal antibody specifically recognizes the 90-100-kDa β chain shared by the IL-2 and IL-15 receptors (IL-2Rβ, CD122). In the periphery, CD122 is expressed on CD8+ T lymphocytes, NK cells, NK-T cells, dendritic epidermal T cells, subsets of intraepithelial lymphocytes, and macrophages. Small subsets of fetal and adult thymocytes constitutively express CD122. CD122+ cells in the bone marrow include committed NK-cell progenitors. IL-2Rβ expression is upregulated by IL-2. CD122 is a transmembrane glycoprotein of the hematopoietin receptor superfamily which can combine with CD132 (γc) alone or CD132 plus CD25 (IL-2Rα) to form intermediate or high-affinity IL-2 receptor complexes, respectively. The β chain of these complexes, CD122, is involved in signal transduction and immunoregulation. The TM-β1 antibody blocks high affinity binding of IL-2 or IL-15 to IL-2Rβ.

940173 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940173 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940173" on CiteAb

Development References (18)

  1. Alleva DG, Kaser SB, Monroy MA, Fenton MJ, Beller DI. IL-15 functions as a potent autocrine regulator of macrophage proinflammatory cytokine production: evidence for differential receptor subunit utilization associated with stimulation or inhibition. J Immunol. 1997; 159(6):2941-2951. (Clone-specific: Blocking). View Reference
  2. Bendelac A. Mouse NK1+ T cells. Curr Opin Immunol. 1995; 7(3):367-374. (Biology). View Reference
  3. Cho BK, Wang C, Sugawa S, Eisen HN, Chen J. Functional differences between memory and naive CD8 T cells. Proc Natl Acad Sci U S A. 1999; 96(6):2976-2981. (Biology). View Reference
  4. Giri JG, Ahdieh M, Eisenman J, et al. Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 1994; 13(12):2822-2830. (Biology). View Reference
  5. Guy-Grand D, Cuenod-Jabri B, Malassis-Seris M, Selz F, Vassalli P. Complexity of the mouse gut T cell immune system: identification of two distinct natural killer T cell intraepithelial lineages. Eur J Immunol. 1996; 26(9):2248-2256. (Clone-specific: Flow cytometry). View Reference
  6. Hanke T, Mitnacht R, Boyd R, Hunig T. Induction of interleukin 2 receptor beta chain expression by self-recognition in the thymus. J Exp Med. 1994; 180(5):1629-1636. (Clone-specific: Flow cytometry). View Reference
  7. Kondo M, Ohashi Y, Tada K, Nakamura M, Sugamura K. Expression of the mouse interleukin-2 receptor gamma chain in various cell populations of the thymus and spleen. Eur J Immunol. 1994; 24(9):2026-2030. (Biology). View Reference
  8. Ku CC, Murakami M, Sakamoto A, Kappler J, Marrack P. Control of homeostasis of CD8+ memory T cells by opposing cytokines. Science. 2000; 288(5466):675-678. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  9. Malek TR, Furse RK, Fleming ML, Fadell AJ, He YW. Biochemical identity and characterization of the mouse interleukin-2 receptor beta and gamma c subunits. J Interferon Cytokine Res. 1995; 15(5):447-454. (Clone-specific: Immunoprecipitation). View Reference
  10. Nakanishi K, Hirose S, Yoshimoto T, et al. Role and regulation of interleukin (IL)-2 receptor alpha and beta chains in IL-2-driven B-cell growth. Proc Natl Acad Sci U S A. 1992; 89(8):3551-3555. (Clone-specific: Blocking). View Reference
  11. Ohno H, Ono S, Hirayama N, Shimada S, Saito T. Preferential usage of the Fc receptor gamma chain in the T cell antigen receptor complex by gamma/delta T cells localized in epithelia. J Exp Med. 1994; 179(1):365-369. (Clone-specific: Flow cytometry). View Reference
  12. Rosmaraki EE, Douagi I, Roth C, Colucci F, Cumano A, Di Santo JP. Identification of committed NK cell progenitors in adult murine bone marrow. Eur J Immunol. 2001; 31(6):1900-1909. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  13. Suzuki H, Kundig TM, Furlonger C et al. Deregulated T cell activation and autoimmunity in mice lacking interleukin-2 receptor beta. Science. 1995; 268(5216):1472-1476. (Clone-specific: Blocking). View Reference
  14. Takeuchi Y, Tanaka T, Hamamura K et al. Expression and role of interleukin-2 receptor beta chain on CD4-CD8- T cell receptor alpha beta+ cells. Eur J Immunol. 1992; 22(11):2929-2935. (Clone-specific: Blocking). View Reference
  15. Tanaka T, Takeuchi Y, Shiohara T et al. In utero treatment with monoclonal antibody to IL-2 receptor beta-chain completely abrogates development of Thy-1+ dendritic epidermal cells. Int Immunol. 1992; 4(4):487-491. (Biology). View Reference
  16. Tanaka T, Tsudo M, Karasuyama H, et al. A novel monoclonal antibody against murine IL-2 receptor beta-chain. Characterization of receptor expression in normal lymphoid cells and EL-4 cells. J Immunol. 1991; 147(7):2222-2228. (Immunogen: Flow cytometry, Immunoprecipitation, Inhibition). View Reference
  17. Taniguchi T, Minami Y. The IL-2/IL-2 receptor system: a current overview. Cell. 1993; 73(1):5-8. (Biology). View Reference
  18. Zhang X, Sun S, Hwang I, Tough DF, Sprent J. Potent and selective stimulation of memory-phenotype CD8+ T cells in vivo by IL-15. Immunity. 1998; 8(5):591-599. (Clone-specific). View Reference
View All (18) View Less
940173 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.