Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD100 (Sema4D)

BD™ AbSeq Oligo Rat Anti-Mouse CD100 (Sema4D)

Clone BMA-12 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Semaphorin-4D; SEM4D; Semaphorin-C-like 2; Semacl2; Semaj; M-Sema G; coll-4
20354
2 µl
Rat IgG2a, λ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTCGGGATTGTCTGTGTACGGTAGCATTGATTTAGT
AMM2245
Mouse CD100 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940482 Rev. 2
Antibody Details
Down Arrow Up Arrow
BMA-12

The BMA-12 monoclonal antibody specifically binds to CD100 which is also known as, Semaphorin-4D (Sema4D), or Collapsin-4 (Coll-4). CD100 is a ~150 kDa type I transmembrane glycoprotein that belongs to the class IV Semaphorin subfamily within the Ig gene superfamily. CD100 is expressed by cells from a broad range of tissues including the nervous system, where it serves in axon guidance and synapse formation, and the kidney. It is expressed by most hematopoietic cells including T cells which express CD100 more abundantly than B cells and dendritic cell subsets. Its expression is significantly upregulated upon activation of these cell types. CD100 can costimulate T cell responses. For B cells and dendritic cells, CD100 interaction with its ligands, CD72 or Plexin B1, induces cellular activation and promotes survival, respectively. CD100 is also known to interact with Plexin B2 on skin gamma delta T cells and contribute to the repair of tissue damage caused by inflammation. A biologically-active, soluble form of CD100 is generated by proteolytic cleavage of the cell surface form.

940482 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940482 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940482" on CiteAb

Development References (6)

  1. Kikutani H, Kumanogoh A. Semaphorins in interactions between T cells and antigen-presenting cells. Nat Rev Immunol. 2003; 3(2):159-167. (Biology). View Reference
  2. Kumanogoh A, Watanabe C, Lee I, et al. Identification of CD72 as a lymphocyte receptor for the class IV semaphorin CD100: a novel mechanism for regulating B cell signaling. Immunity. 2000; 13(5):621-631. (Immunogen: Blocking, ELISA, Flow cytometry). View Reference
  3. Li DH, Tung JW, Tarner IH, et al. CD72 down-modulates BCR-induced signal transduction and diminishes survival in primary mature B lymphocytes. J Immunol. 2006; 176(9):5321-5328. (Biology). View Reference
  4. Meehan TF, Witherden DA, Kim CH, et al. Protection against colitis by CD100-dependent modulation of intraepithelial gammadelta T lymphocyte function. Mucosal Immunol. 2014; 7(1):134-142. (Biology). View Reference
  5. Smith EP, Shanks K, Lipsky MM, DeTolla LJ, Keegan AD, Chapoval SP. Expression of neuroimmune semaphorins 4A and 4D and their receptors in the lung is enhanced by allergen and vascular endothelial growth factor.. BMC Immunol. 2011; 12:30. (Clone-specific: Flow cytometry). View Reference
  6. Wang X, Kumanogoh A, Watanabe C, Shi W, Yoshida K, Kikutani H. Functional soluble CD100/Sema4D released from activated lymphocytes: possible role in normal and pathologic immune responses. Blood. 2001; 97(11):3498-3504. (Clone-specific: ELISA, Flow cytometry, Immunoaffinity chromatography, Immunoprecipitation). View Reference
View All (6) View Less
940482 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.