Skip to main content Skip to navigation
Oligo Mouse Anti-Human P-glycoprotein (CD243)

BD™ AbSeq Oligo Mouse Anti-Human P-glycoprotein (CD243)

Clone 17F9

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD243; ABCB1; ABC20; CLCS; GP170; MDR1; P-GP; PGY1
5243
2 µl
Mouse BALB/c IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GATAATAGGGCGGATGAGAATGCGTAAGTTGAAGCT
AHS0250
Human MDR1 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940503 Rev. 3
Antibody Details
Down Arrow Up Arrow
17F9

The 17F9 monoclonal antibody specifically binds to the 170-180 kDa transmembrane glycoprotein (P-glycoprotein), a product of the multidrug resistance-1 (MDR1) gene. This glycoprotein is expressed on MDR positive cells and has been reported to be expressed on many normal tissues, such as adrenal glands and endothelium, in the brain and skin. P-glycoprotein is known to impart drug resistance to cells by pumping many anti-cancer drugs out of the cytoplasm. 17F9 antibody is able to partially block the binding  of UIC2 antibody (another MDR-specific monoclonal antibody).

940503 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940503 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Aihara M, Aihara Y, Schmidt-Wolf G, et al. A combined approach for purging multidrug-resistant leukemic cell lines in bone marrow using a monoclonal antibody and chemotherapy.. Blood. 1991; 77(9):2079-84. (Immunogen: Depletion, Flow cytometry). View Reference
  2. Benard J, Bourhis J, Riou G. Clinical significance of multiple drug resistance in human cancers. Anticancer Res. 1990; 10(5A):1297-1302. (Biology). View Reference
  3. Goldstein LJ, Galski H, Fojo A, et al. Expression of a multidrug resistance gene in human cancers. J Natl Cancer Inst. 1989; 81(2):116-124. (Biology). View Reference
  4. Shi T, Wrin J, Reeder J, Liu D, Ring DB. High-affinity monoclonal antibodies against P-glycoprotein. Clin Immunol Immunopathol. 1995; 76(1):44-51. (Immunogen: ELISA, Immunoprecipitation, Radioimmunoassay). View Reference
940503 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.