Skip to main content Skip to navigation
Oligo Mouse Anti-Human HLA-DR, DP, DQ

BD™ AbSeq Oligo Mouse Anti-Human HLA-DR, DP, DQ

Clone Tu39 (also known as TÜ39)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Tü39; MHC class II HLA-DR, DP, DQ
3113, 3117, 3118, 3119, 3122, 3123, 3125, 3126, 3127
2 µl
Mouse IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAATCGAGTTTATAGGTGGCGTTAGTAGTTGTGGGC
AHS0149
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940235 Rev. 2
Antibody Details
Down Arrow Up Arrow
Tu39

The TU39 monoclonal antibody specifically recognizes human major histocompatibility (MHC) Class II HLA-DR, DP and most DQ antigens. These antigens are encoded by genes within the Human Leukocyte Antigen (HLA) Complex located on chromosome 6. MHC Class II antigens are transmembrane heterodimeric glycoproteins composed of α chain (36 kDa) and β chain (27 kDa) subunits. They are expressed primarily on antigen presenting cells which include dendritic cells, monocytes, macrophages, thymic epithelial cells, and B cells.  They are also expressed on activated T cells. This molecule plays a major role in mediating cellular interactions during antigen presentation to CD4+ T lineage cells. The TU39 antibody is reportedly useful for immunophenotyping as well as functional studies including the inhibition of mixed lymphocyte reactions and antibody-mediated complement fixation on target cells.

940235 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940235 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Barclay NA, Brown MH, Birkeland ML, et al, ed. The Leukocyte Antigen FactsBook. San Diego, CA: Academic Press; 1997.
  2. Pawelec G, Ziegler A, Wernet P. Dissection of human allostimulatory determinants with cloned T cells: stimulation inhibition by monoclonal antibodies TU22, 34, 35, 36, 37, 39, 43, and 58 against distinct human MHC class II molecules. Hum Immunol. 1985; 12(3):165-176. (Clone-specific). View Reference
  3. Pawelec GP, Shaw S, Ziegler A, Muller C, Wernet P. Differential inhibition of HLA-D- or SB-directed secondary lymphoproliferative responses with monoclonal antibodies detecting human Ia-like determinants. J Immunol. 1982; 129(3):1070-1075. (Clone-specific: Cytotoxicity, Immunoprecipitation, Inhibition). View Reference
  4. Ziegler A, Heinig J, Muller C, et al. Analysis by sequential immunoprecipitations of the specificities of the monoclonal antibodies TU22,34,35,36,37,39,43,58 and YD1/63.HLK directed against human HLA class II antigens. Immunobiology. 1986; 171(1-2):77-92. (Clone-specific). View Reference
940235 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.