Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD99

BD™ AbSeq Oligo Mouse Anti-Human CD99

Clone TÜ12

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
E2; MIC2
4267
2 µl
Mouse IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGATTGTCGTAGGCGTTTGCGTAGGTATATGCGTTG
AHS0123
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940214 Rev. 2
Antibody Details
Down Arrow Up Arrow
TÜ12

The TÜ12 monoclonal antibody specifically recognizes CD99, also referred to as E2 antigen, a 32 kDa sialoglycoprotein expressed on all leucocyte lineages. The E2 antigen is the MIC2 gene product and is differentially expressed during T- and B-lymphoid and granulocytic development, with higher densities being expressed during early hematopoietic stages. Mature granulocytes express  very little or no CD99. E2 has been shown to be involved in T-cell adhesion processes and is suggested to have a functional role in hematopoietic adhesion pathways.

940214 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940214 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Aussel C, Bernard G, Breittmayer JP, Pelassy C, Zoccola D, Bernard A. Monoclonal antibodies directed against the E2 protein (MIC2 gene product) induce exposure of phosphatidylserine at the thymocyte cell surface. Biochemistry. 1993; 32(38):10096-10101. (Biology). View Reference
  2. Chang A, Benda PM, Wood BL, Kussick SJ. Lineage-specific identification of nonhematopoietic neoplasms by flow cytometry.. Am J Clin Pathol. 2003; 119(5):643-55. (Clone-specific: Flow cytometry). View Reference
  3. Dworzak MN, Fritsch G, Buchinger P, et al. Flow cytometric assessment of human MIC2 expression in bone marrow, thymus, and peripheral blood. Blood. 1994; 83(2):415-425. (Biology). View Reference
  4. Gelin C, Aubrit F, Phalipon A, et al. The E2 antigen, a 32 kd glycoprotein involved in T-cell adhesion processes, is the MIC2 gene product. EMBO J. 1989; 8(11):3253-3259. (Biology). View Reference
  5. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  6. Uchańska-Ziegler B, Wernet P, Ziegler A. Differentiation of a human myeloid cell line (HL-60) toward granulocyte- and macrophage-like cells: comparison of cell surface antigen expression.. Haematol Blood Transfus. 1983; 28:386-8. (Clone-specific: Immunofluorescence). View Reference
View All (6) View Less
940214 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.