Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD23

BD™ AbSeq Oligo Mouse Anti-Human CD23

Clone EBVCS-5 (also known as EBVCS 5) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD23A; Fc-epsilon-RII; FCER2; FCE2; IGEBF; BLAST-2; CLEC4J; Leu-20
2208
2 µl
Mouse BALB.B IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTGATGTGGGCGGGTTGTATTACGGTTTCGAGTCT
AHS0210
Epstein-Barr Virus Transformed Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940288 Rev. 2
Antibody Details
Down Arrow Up Arrow
EBVCS-5

The EBVCS-5 antibody specifically binds to human CD23, the low affinity receptor for human IgE (Fc epsilon RII or FcεRII), which is also known as C-type lectin domain family 4 member J (CLEC4J). CD23 is expressed as a ~45 kDa type II membrane glycoprotein that is present at low density on most normal B lymphocytes and at higher levels on activated B lymphocytes, Epstein-Barr virus (EBV)-transformed lymphoblasts, chronic lymphocytic leukemia (CLL) cells of B-lymphocyte origin, and tonsillar B lymphocytes. CD23 expression is induced on B cells by interleukin-4 (IL-4) and is lost after isotype switching to IgA, IgG, or IgE. The CD23 antigen is not present on immature bone marrow B lymphocytes or on T lymphocytes. CD23 may also be differentially expressed on monocytes, macrophages, eosinophils, platelets, dendritic cells, and Langerhans cells. CD23 can mediate IgE-dependent cytotoxicity and phagocytosis by macrophages and eosinophils. Soluble CD23 (sCD23) can be released by CD23-positive cells as a result of proteolytic cleavage of membrane CD23. Larger fragments of sCD23 (eg, 25-37 kDa) retain their IgE-binding capacity whereas smaller fragments (ie, ≤ 12 kDa) do not. Soluble CD23 may have immunoregulatory effects on the growth and differentiation of B cells and other cell types.

940288 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940288 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940288" on CiteAb

Development References (11)

  1. Bieber T, Rieger A, Neuchrist C, et al. Induction of Fc epsilon R2/CD23 on human epidermal Langerhans cells by human recombinant interleukin 4 and gamma interferon.. J Exp Med. 1989; 170(1):309-14. (Biology). View Reference
  2. Capron M, Jouault T, Prin L, et al. Functional study of a monoclonal antibody to IgE Fc receptor (Fc epsilon R2) of eosinophils, platelets, and macrophages.. J Exp Med. 1986; 164(1):72-89. (Biology). View Reference
  3. Choe J, Kim HS, Armitage RJ, Choi YS. The functional role of B cell antigen receptor stimulation and IL-4 in the generation of human memory B cells from germinal center B cells.. J Immunol. 1997; 159(8):3757-66. (Clone-specific: Flow cytometry). View Reference
  4. Dugas B, Paul-Eugene N, Cairns J, et al. Leukotriene B4 potentiates the expression and release of Fc epsilon RII/CD23, and proliferation and differentiation of human B lymphocytes induced by IL-4.. J Immunol. 1990; 145(10):3406-11. (Clone-specific: ELISA). View Reference
  5. Kikutani H, Inui S, Sato R, et al. Molecular structure of human lymphocyte receptor for immunoglobulin E.. Cell. 1986; 47(5):657-65. (Biology). View Reference
  6. Kikutani H, Suemura M, Owaki H, et al. Fc epsilon receptor, a specific differentiation marker transiently expressed on mature B cells before isotype switching.. J Exp Med. 1986; 164(5):1455-69. (Biology). View Reference
  7. Nadler LM. B Cell/Leukemia Panel Workshop: summary and comments. In: Reinherz EL, Haynes BF, Nadler LM, Bernstein ID, ed. Leukocyte Typing II: Human B Lymphocytes. New York: Springer-Verlag; 1986:3-43.
  8. Rieber EP, Rank G, Kohler I, Krauss S. Membrane expression of Fc epsilon RII/CD23 and release of soluble CD23 by follicular dendritic cells. Adv Exp Med Biol. 1993; 329:393-398. (Biology). View Reference
  9. Sarfati M, Ishihara H, Delespesse G. CD23 Workshop Panel report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:530-533.
  10. Sugden B, Metzenberg S. Characterization of an antigen whose cell surface expression is induced by infection with Epstein-Barr virus.. J Virol. 1983; 46(3):800-7. (Immunogen: Immunoprecipitation, Radioimmunoassay). View Reference
  11. Yukawa K, Kikutani H, Owaki H, et al. A B cell-specific differentiation antigen, CD23, is a receptor for IgE (Fc epsilon R) on lymphocytes.. J Immunol. 1987; 138(8):2576-80. (Biology). View Reference
View All (11) View Less
940288 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.