Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD212

BD™ AbSeq Oligo Mouse Anti-Human CD212

Clone 2.4E6 (also known as 2-4E6)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
IL-12R beta 1; IL-12R-BETA1; IL-12 receptor β1; IMD30
3594
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAGTAGTATTAGTATCTTGCGTTATGGACCAGGTG
AHS0185
PHA-activated Human PBMC
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940267 Rev. 2
Antibody Details
Down Arrow Up Arrow
2.4E6

The 2.4E6 monoclonal antibody specifically binds to CD212, which is also known as the Interleukin-12 Receptor beta-1 chain (IL12RB1/IL-12RB1/IL-12Rβ1). CD212 serves as a subunit for the functional IL-12 Receptor (IL-12Rβ1-IL-12Rβ2) and IL-23 Receptor (IL-12Rβ1-IL-23R) complexes. CD212 is expressed on T cells, B cells, or NK cells. CD212 is a type I transmembrane glycoprotein that belongs to the hemopoietin receptor superfamily. CD212 is responsible for binding to the IL-12 p40 subunit that is common to the heterodimeric IL-12 and IL-23 cytokines. IL-12 and IL-23 are immunomodulatory cytokines produced mainly by antigen-presenting cells (APC) including monocytes and dendritic cells. These cytokines have overlapping as well as distinct biological activities.

940267 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940267 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Chua AO, Chizzonite R, Desai BB, et al. Expression cloning of a human IL-12 receptor component. A new member of the cytokine receptor superfamily with strong homology to gp130. J Immunol. 1994; 153(1):128-136. (Immunogen). View Reference
  2. Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002.
  3. Parham C, Chirica M, Timans J, et al. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol. 2002; 168(11):5699-5708. (Biology). View Reference
  4. Presky DH, Minetti LJ, Gillessen S, et al. Analysis of the multiple interactions between IL-12 and the high affinity IL-12 receptor complex. J Immunol. 1998; 160(5):2174-2179. (Biology). View Reference
  5. Robinson RT. IL12Rbeta1: The cytokine receptor that we used to know. Cytokine. 2014; 71(2):348-359. (Clone-specific: Electron microscopy, Immunoprecipitation). View Reference
  6. Wu CY, Warrier RR, Carvajal DM, et al. Biological function and distribution of human interleukin-12 receptor beta chain. Eur J Immunol. 1996; 26(2):345-350. (Biology). View Reference
View All (6) View Less
940267 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.