Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD193

BD™ AbSeq Oligo Mouse Anti-Human CD193

Clone 5E8 (also known as 5E8-G9-B4)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CCR3: Chemokine (C-C motif) receptor 3; C-C CKR-3; CKR3; CMKBR3
1232
2 µl
Mouse C57BL/6 IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAGATTGATTGGCCGACTTAGTTTGTTACGTTAGGG
AHS0159
Human CCR3 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940245 Rev. 3
Antibody Details
Down Arrow Up Arrow
5E8

The 5E8 monoclonal antibody specifically binds to human CCR3 which is also known as CD193. CCR3 is a G protein-linked, 7 transmembrane, chemokine receptor expressed on a variety of hematopoietic cells. Similar to CCR5 and CXCR4, CCR3 can be a co-receptor for HIV-1. It is primarily expressed by eosinophils and basophils during atopic conditions, dermatitis, allergic rhinitis, conjunctivitis and bronchial asthma. Chemokines including RANTES, Eotaxin, MCP-3, MIP1α have been reported to act as ligands for CCR3 and stimulate CCR3+ cells. Eotaxin stimulates Th2 cells expressing CCR3. Other studies describe HIV-1 specific T cell cytotoxicity can be mediated by RANTES and Eotaxin through CCR3. CCR3 expressed on dendritic cells may have a biological role on cell-cell interaction during antigen presentation. CCR3 has been clustered as CD193 in the HLDA VIIIth workshop.

940245 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940245 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (9)

  1. Agrawal L, Maxwell CR, Peters PJ, et al. Complexity in human immunodeficiency virus type 1 (HIV-1) co-receptor usage: roles of CCR3 and CCR5 in HIV-1 infection of monocyte-derived macrophages and brain microglia. J Gen Virol. 2009; 90(3):710-722. (Clone-specific: Flow cytometry, Immunofluorescence). View Reference
  2. Daugherty BL, Siciliano SJ, DeMartino JA, Malkowitz L, Sirotina A, Springer MS. Cloning, expression, and characterization of the human eosinophil eotaxin receptor. J Exp Med. 1996; 83(5):2349-2354. (Biology). View Reference
  3. Ghorpade A, Xia MQ, Hyman BT, et al. Role of the beta-chemokine receptors CCR3 and CCR5 in human immunodeficiency virus type 1 infection of monocytes and microglia. J Virol. 1998; 72(4):3351-3361. (Biology). View Reference
  4. Hadida F, Vieillard V, Autran B, Clark-Lewis I, Baggiolini M, Debre P. HIV-specific T cell cytotoxicity mediated by RANTES via the chemokine receptor CCR3. J Exp Med. 1998; 188(3):609-614. (Biology). View Reference
  5. Heath H, Qin S, Rao P, et al. Chemokine receptor usage by human eosinophils. The importance of CCR3 demonstrated using an antagonistic monoclonal antibody. J Clin Invest. 1997; 99(2):178-184. (Immunogen: Flow cytometry). View Reference
  6. Liu SM, Xavier R, Good KL, et al. Immune cell transcriptome datasets reveal novel leukocyte subset-specific genes and genes associated with allergic processes.. J Allergy Clin Immunol. 2006; 118(2):496-503. (Clone-specific). View Reference
  7. Sallusto F, Mackay CR, Lanzavecchia A. Selective expression of the eotaxin receptor CCR3 by human T helper 2 cells. Science. 1997; 277(5334):2005-2007. (Biology). View Reference
  8. Sato K, Kawasaki H, Nagayama H, et al. CC chemokine receptors, CCR-1 and CCR-3, are potentially involved in antigen-presenting cell function of human peripheral blood monocyte-derived dendritic cells. Blood. 1999; 93(1):34-42. (Biology). View Reference
  9. Zimmermann N, Daugherty BL, Stark JM, Rothenberg ME. Molecular analysis of CCR-3 events in eosinophilic cells. J Immunol. 2000; 164(2):1055-1064. (Biology). View Reference
View All (9) View Less
940245 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.