Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD144

BD™ AbSeq Oligo Mouse Anti-Human CD144

Clone 55-7H1

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
VE-cadherin; Cadherin-5; CDH5; Vascular endothelial cadherin
1003
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGATATATTTCGCGGGTTTGGTAGGTTAAGTGCTCG
AHS0253
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940376 Rev. 2
Antibody Details
Down Arrow Up Arrow
55-7H1

The 55-7H1 antibody monoclonal antibody specifically binds to a calcium-independent epitope on Cadherin-5, a member of the cadherin family of calcium-dependent adhesion molecules. Cadherin-5 is also known as CD144 or VE-Cadherin. CD144 is expressed on endothelial cells in vivo and in vitro. It may play a role in the organization of lateral endothelial junctions and in the control of permeability properties of vascular endothelium.

940376 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940376 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Breier G, Breviario F, Caveda L, et al. Molecular cloning and expression of murine vascular endothelial-cadherin in early stage development of cardiovascular system.. Blood. 1996; 87(2):630-41. (Biology). View Reference
  2. Lampugnani MG, Resnati M, Raiteri M, et al. A novel endothelial-specific membrane protein is a marker of cell-cell contacts.. J Cell Biol. 1992; 118(6):1511-22. (Biology). View Reference
  3. Limaye V, Li X, Hahn C, et al. Sphingosine kinase-1 enhances endothelial cell survival through a PECAM-1-dependent activation of PI-3K/Akt and regulation of Bcl-2 family members.. Blood. 2005; 105(8):3169-77. (Clone-specific: Flow cytometry). View Reference
  4. Litwin M, Clark K, Noack L, et al. Novel cytokine-independent induction of endothelial adhesion molecules regulated by platelet/endothelial cell adhesion molecule (CD31).. J Cell Biol. 1997; 139(1):219-28. (Clone-specific: Flow cytometry). View Reference
  5. Martin-Padura I, Lostaglio S, Dejana E. CD144 (VEcadherin) workshop panel report. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:752-754.
  6. Mutin M, Dignat-George F, Sampol J. Immunologic phenotype of cultured endothelial cells: quantitative analysis of cell surface molecules.. Tissue Antigens. 1997; 50(5):449-58. (Clone-specific: Flow cytometry). View Reference
  7. Vincent PA, Xiao K, Buckley KM, Kowalczyk AP. VE-cadherin: adhesion at arm's length.. Am J Physiol, Cell Physiol. 2004; 286(5):C987-97. (Biology). View Reference
View All (7) View Less
940376 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.