Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD131

BD™ AbSeq Oligo Mouse Anti-Human CD131

Clone 3D7

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CSF2RB; Cytokine receptor common β; βc; CDw131; IL-3Rβ/IL-5Rβ/GM-CSFRβ
1439
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTCTTCGGGATGGGTTCGTATGCGTAGTCGTGATGT
AHS0263
Human CD131 Transfected COS Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940385 Rev. 2
Antibody Details
Down Arrow Up Arrow
3D7

The 3D7 antibody reacts with CD131, the 120 kD common β chain (βc) which is shared with the receptor complexes for human granulocyte-macrophage colony stimulating factor (GM-CSFR), interleukin-3 (IL-3R) and interleukin-5 (IL-5R). Together with the α subunit of either the IL-3R (IL-3Rα), IL-5R (IL-5Rα), or GM- CSFR (GM-CSFRα), the common β chain forms high-affinity, signaling receptors for human IL-3, IL-5 and GM-CSF, respectively. Cell surface βc are expressed by a variety of different cell types including hematopoietic progenitor cells derived from pluripotent stem cells, monocytes, neutrophils, eosinophils, basophils, endothelial cells, fibroblasts, and Langerhans cells. The immunogen used to generate this hybridoma was cells co-transfected with expression vectors which contained cDNA for the human IL-3 α and β chains.

940385 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940385 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Macardle PJ, Chen Z, Shih CY, et al. Characterization of human leucocytes bearing the IL-3 receptor. Cell Immunol. 1996; 168(1):59-68. (Clone-specific: Flow cytometry). View Reference
  2. Woodcock JM, Zacharakis B, Plaetinck G. Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 1994; 13(21):5176-5185. (Immunogen: Flow cytometry, Immunoprecipitation). View Reference
  3. Zola H, Swart B, Banham A, et al. CD molecules 2006--human cell differentiation molecules.. J Immunol Methods. 2007; 319(1-2):1-5. (Clone-specific: Flow cytometry). View Reference
  4. Zola H. Detection of cytokine receptors by flow cytometry. In: Coligan JE, Kruisbeek AM, Margulies DH, Shevach EM, Strober W, ed. Current Protocols in Immunology. New York: Green Publishing Associates and Wiley-Interscience; 1995:6.21.1-6.21.18.
940385 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.