Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD114

BD™ AbSeq Oligo Mouse Anti-Human CD114

Clone LMM741 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
GCSFR; G-CSF Receptor; G-CSF-R; G-CSFR; HG-CSFR; CSF3R
1441
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGTTAGCGTGTCATTGATCGATTGTAGGTGGAGCG
AHS0272
G-CSFR cDNA transfected cells.
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940393 Rev. 2
Antibody Details
Down Arrow Up Arrow
LMM741

The LMM741 monoclonal antibody specifically recognizes CD114 which is also known as the Granulocyte-Colony Stimulating Factor Receptor (G-CSFR). CD114 is a ~150 kDa type I transmembrane glycoprotein that is encoded by CSF3R (colony stimulating factor 3 receptor) and belongs to the class 1 cytokine receptor family. CD114 is expressed on granulocytes, monocytes, dendritic cells, endothelial cells, platelets, placenta and myeloid leukemias and a variety of tumor cell lines. CD114 serves as the receptor for granulocyte colony stimulating factor (G-CSF) which plays a role in myeloid cell proliferation and differentiation. The immunogen used to generate this hybridoma was cells transfected with an expression vector containing a full-length cDNA encoding the human G-CSFR.

940393 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940393 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940393" on CiteAb

Development References (2)

  1. Kasper B, Welte K, Hadam MR. CD114 (granulocyte-colony stimulating factor receptor) Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:1072-1074.
  2. Nicholson SE, Oates AC, Harpur AG, Ziemiecki A, Wilks AF, Layton JE. Tyrosine kinase JAK1 is associated with the granulocyte-colony-stimulating factor receptor and both become tyrosine-phosphorylated after receptor activation. Proc Natl Acad Sci U S A. 1994; 91(8):2985-2988. (Immunogen: Immunoprecipitation, Western blot). View Reference
940393 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.