Skip to main content Skip to navigation
Oligo Mouse Anti-Human CCR2 (CD192)

BD™ AbSeq Oligo Mouse Anti-Human CCR2 (CD192)

Clone LS132.1D9 (also known as 1D9)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CCR2; CD192; CKR2; CC-CKR-2; CMKBR2; MCP-1 receptor; MCP-1-R
729230
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CATGAGTGAGGCGATATAGTGAGCGGTTTGTAGATT
AHS0208
Human CCR2 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940286 Rev. 2
Antibody Details
Down Arrow Up Arrow
LS132.1D9

The LS132.1D9 (aka, 1D9) monoclonal antibody specifically recognizes C-C chemokine receptor type 2 (CCR2 or CC-CKR-2) which is also known as CD192, CKR2, CMKBR2, or Monocyte chemoattractant protein 1 receptor (MCP-1 Receptor or MCP-1-R). CCR2 (CD192) is a seven-transmembrane, G-protein-coupled, glycoprotein receptor that belongs to the beta chemokine receptor family. It is expressed on basophils, monocytes/macrophages, dendritic cells, activated T cells and B cells. CCR2 (CD192) serves as a receptor for Monocyte chemoattractant protein 1 (MCP-1/CCL2), MCP-2/CCL8, MCP-3/CCL7, and MCP-4/CCL13. CD192 exists in two forms, CD192A and CD192B. The two forms are derived from alternatively spliced variants of a single gene and differ at their intracellular C-terminal ends. CD192 plays an important role in inflammatory responses including monocytic infiltration of tissues associated with certain diseases, eg, atherosclerosis, rheumatoid arthritis, and tumors.

940286 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940286 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (3)

  1. Andrew DP, Ruffing N, Kim CH, et al. C-C chemokine receptor 4 expression defines a major subset of circulating nonintestinal memory T cells of both Th1 and Th2 potential. J Immunol. 2000; 166(1):103-111. (Clone-specific). View Reference
  2. Martinelli R, Sabroe I, LaRosa G, Williams TJ, Pease JE. The CC chemokine eotaxin (CCL11) is a partial agonist of CC chemokine receptor 2b.. J Biol Chem. 2001; 276(46):42957-64. (Clone-specific). View Reference
  3. Sica A, Saccani A, Bottazzi B, et al. Defective expression of the monocyte chemotactic protein-1 receptor CCR2 in macrophages associated with human ovarian carcinoma.. J Immunol. 2000; 164(2):733-8. (Clone-specific). View Reference
940286 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.