Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD272

BD™ AbSeq Oligo Hamster Anti-Mouse CD272

Clone HMBT-6B2 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Btla; B and T lymphocyte attenuator; B- and T-lymphocyte-associated protein
208154
2 µl
Hamster IgG
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAAGTTAGTGGTTTGCGTCGTAGAATCATGGGTGGT
AMM2166
Mouse CD272
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.
940415 Rev. 2
Antibody Details
Down Arrow Up Arrow
HMBT-6B2

The HMBT-6B2 monoclonal antibody specifically binds to CD272 which is also known as B- and T-lymphocyte attenuator (BTLA). CD272 is a type 1 transmembrane glycoprotein and a member of the Ig superfamily. CD272 is variably expressed on developing and mature T and B lymphocytes, NKT cells, NK cells, macrophages and dendritic cells. CD272 expression is upregulated by activated T cells including Th1, Th2, and T follicular helper cells and by anergic T cells.  CD272 is structurally similar to CD152/CTLA-4 and CD279/PD-1 and functions as a coinhibitory receptor for B and T cell responses.  Herpesvirus entry mediator (HVEM), also known as CD270 and LIGHT-R, has been identified as a ligand for CD272. The crosslinking of CD272 by HVEM inhibits T-cell proliferation and cytokine production.

940415 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940415 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940415" on CiteAb

Development References (7)

  1. Han P, Goularte OD, Rufner K, Wilkinson B, Kaye J. An inhibitory Ig superfamily protein expressed by lymphocytes and APCs is also an early marker of thymocyte positive selection. J Immunol. 2004; 172(10):5931-5939. (Biology). View Reference
  2. Hurchla MA, Sedy JR, Gavrieli M, Drake CG, Murphy TL, Murphy KM. B and T lymphocyte attenuator exhibits structural and expression and is highly induced in anergic CD4+T cells. J Immunol. 2005; 174(6):3377-3385. (Biology). View Reference
  3. Ishida W, Fukuda K, Kajisako M, et al. B and T lymphocyte attenuator regulates the development of antigen-induced experimental conjunctivitis. Graefes Arch Clin Exp Ophthalmol. 2012; 250(2):289-295. (Immunogen: In vivo exacerbation). View Reference
  4. Nurieva RI, Chung Y, Martinez GJ, et al. Bcl6 mediates the development of T follicular helper cells. Science. 2009; 325(5943):1001-1005. (Biology). View Reference
  5. Sedy JR, Gavrieli M, Potter KG, et al. B and T lymphocyte attenuator regulates T cell activation through interaction with herpesvirus entry mediator. Nat Immunol. 2005; 6(1):90-98. (Biology). View Reference
  6. Watanabe N, Gavrieli M, Sedy JR, et al. BTLA is a lymphocyte inhibitory receptor with similarities to CTLA-4 and PD-1. Nat Immunol. 2003; 4(7):670-679. (Biology). View Reference
  7. Watanabe N, Nakajima H. Coinhibitory molecules in autoimmune diseases. Clin Dev Immunol. 2012; 2012:1-7. (Biology). View Reference
View All (7) View Less
940415 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.