Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD13

BD™ AbSeq Oligo Mouse Anti-Human CD13

Clone WM15

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
ANPEP; APN; Aminopeptidase N; Alanyl aminopeptidase; LAP1; PEPN
290
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATAATAATAATCGGGTGTTTCGCGGACTGTTGCATG
AHS0050
Human AML Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940044 Rev. 3
Antibody Details
Down Arrow Up Arrow
WM15

The WM15 monoclonal antibody specifically binds to CD13, the 150 kDa Type II integral membrane glycoprotein which is also known as aminopeptidase N. The CD13 antigen is the receptor for human coronavirus 229E, the causative agent for some cases of upper respiratory infection. This antibody binds to GM-progenitor cells, granulocytic and monocytic cells, and mast cells, but not to lymphocytes, platelets or erythrocytes. Aminopeptidase N is involved in the metabolism of many regulatory peptides.

940044 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940044 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Favaloro EJ, Bradstock KF, Kabral A, Grimsley P, Zowtyj H, Zola H. Further characterization of human myeloid antigens (gp160,95; gp150; gp67): investigation of epitopic heterogeneity and non-haemopoietic distribution using panels of monoclonal antibodies belonging to CD-11b, CD-13 and CD-33. Br J Haematol. 1988; 69(2):163-171. (Clone-specific: Blocking, Flow cytometry, Immunohistochemistry, Radioimmunoassay). View Reference
  2. Favaloro EJ, Moraitis N, Bradstock K, Koutts J. Co-expression of haemopoietic antigens on vascular endothelial cells: a detailed phenotypic analysis. Br J Haematol. 1990; 74(4):385-394. (Clone-specific: Flow cytometry). View Reference
  3. Favaloro EJ, Moraitis N, Koutts J, Exner T, Bradstock KF. Endothelial cells and normal circulating haemopoietic cells share a number of surface antigens. Thromb Haemost. 1989; 61(2):217-224. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
  4. Gadd S. Cluster report: CD13. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:782-784.
  5. Look AT, Ashmun RA, Shapiro LH, et al. Report on the CD13 (aminopeptidase N) cluster Workshop. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:784-787.
  6. Yang P, Wang X. COVID-19: a new challenge for human beings.. Cell Mol Immunol. 2020; 17(5):555-557. (Biology). View Reference
  7. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (7) View Less
940044 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.