Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD19

BD™ AbSeq Oligo Rat Anti-Mouse CD19

Clone 1D3

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd19; CD19 antigen; B-lymphocyte antigen CD19
12478
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGCATGTCGTTTGTGGCGTACTATTAAGGTGAAGC
AMM2007
Mouse CD19 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940111 Rev. 2
Antibody Details
Down Arrow Up Arrow
1D3

The 1D3 antibody reacts with CD19, a B lymphocyte-lineage differentiation antigen. CD19, a 95-kDa transmembrance glycoprotein, is a member of the immunoglobulin superfamily and is expressed throughout B-lymphocyte development from the pro-B cell through  the mature B-cell stages. Terminally differentiated plasma cells do not express CD19. On the surface of mature B cells, the CD19 molecule associates with CD21 (CR-2) and CD81 (TAPA-1), and this multimolecular complex synergizes with surface immunoglobulin to promote cellular activation. Studies with CD19-deficient mice have suggested that the level of CD19 expression affects the generation and maturation of B cells in the bone marrow and periphery. B-1 lineage B cells, also known as CD5+ B cells, are drastically reduced or absent in CD19-deficient mice. Increased levels of CD19 expression correlate with increased frequencies of peritonal and splenic B-1 cells and reduced numbers of conventional B lymphocytes in the periphery. CD19 participates in B-lymphocyte development, B-cell activation, maturation of memory B cells and regulation of tolerance. CD19 has also been detected on peritoneal mast cells, co-localized with CD21/CD35, and it is proposed to play a role in complement-mediated mast-cell activation.

940111 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940111 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (12)

  1. Engel P, Zhou LJ, Ord DC, Sato S, Koller B, Tedder TF. Abnormal B lymphocyte development, activation, and differentiation in mice that lack or overexpress the CD19 signal transduction molecule. Immunity. 1995; 3(1):39-50. (Biology). View Reference
  2. Fearon DT. The CD19-CR2-TAPA-1 complex, CD45 and signaling by the antigen receptor of B lymphocytes. Curr Opin Immunol. 1993; 5(3):341-348. (Biology). View Reference
  3. Gommerman JL, Oh DY, Zhou X, et al. A role for CD21/CD35 and CD19 in responses to acute septic peritonitis: a potential mechanism for mast cell activation. J Immunol. 2000; 165(12):6915-6921. (Biology). View Reference
  4. Inaoki M, Sato S, Weintraub BC, Goodnow CC, Tedder TF. CD19-regulated signaling thresholds control peripheral tolerance and autoantibody production in B lymphocytes. J Exp Med. 1997; 186(11):1923-1931. (Biology). View Reference
  5. Krop I, Shaffer AL, Fearon DT, Schlissel MS. The signaling activity of murine CD19 is regulated during cell development. J Immunol. 1996; 157(1):48-56. (Clone-specific: Activation, Calcium Flux, (Co)-stimulation, Flow cytometry, Functional assay, Immunoprecipitation). View Reference
  6. Krop I, de Fougerolles AR, Hardy RR, Allison M, Schlissel MS, Fearon DT. Self-renewal of B-1 lymphocytes is dependent on CD19. Eur J Immunol. 1996; 26(1):238-242. (Immunogen: Flow cytometry, Fluorescence activated cell sorting, Functional assay, Immunoprecipitation, In vivo exacerbation). View Reference
  7. Rickert RC, Rajewsky K, Roes J. Impairment of T-cell-dependent B-cell responses and B-1 cell development in CD19-deficient mice. Nature. 1995; 376(6538):352-355. (Biology). View Reference
  8. Sato S, Jansen PJ, Tedder TF. CD19 and CD22 expression reciprocally regulates tyrosine phosphorylation of Vav protein during B lymphocyte signaling. Proc Natl Acad Sci U S A. 1997; 94(24):13158-13162. (Biology). View Reference
  9. Sato S, Miller AS, Howard MC, Tedder TF. Regulation of B lymphocyte development and activation by the CD19/CD21/CD81/Leu 13 complex requires the cytoplasmic domain of CD19. J Immunol. 1997; 159(7):3278-3287. (Biology). View Reference
  10. Sato S, Ono N, Steeber DA, Pisetsky DS, Tedder TF. CD19 regulates B lymphocyte signaling thresholds critical for the development of B-1 lineage cells and autoimmunity. J Immunol. 1996; 157(10):4371-4378. (Biology). View Reference
  11. Sato S, Steeber DA,Jansen PJ, Tedder TF. CD19 expression levels regulate B lymphocyte development: human CD19 restores normal function in mice lacking endogenous CD19. J Immunol. 1997; 158(10):4662-4669. (Biology). View Reference
  12. Tedder TF, Zhou LJ, Engel P. The CD19/CD21 signal transduction complex of B lymphocytes. Immunol Today. 1994; 15(9):437-442. (Biology). View Reference
View All (12) View Less
940111 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.