Skip to main content Skip to navigation
Oligo Rat Anti-Human CXCR5 (CD185)

BD™ AbSeq Oligo Rat Anti-Human CXCR5 (CD185)

Clone RF8B2 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD185; Chemokine C-X-C motif receptor 5; BLR1; MDR-15
643
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGAAGGTCGATTGTATAACGCGGCATTGTAACGGC
AHS0039
Human CXCR5 (CD185)
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940042 Rev. 3
Antibody Details
Down Arrow Up Arrow
RF8B2

The RF8B2 monoclonal antibody specifically binds to the human CXC chemokine receptor, CXCR5. CXCR5 (also known as CD185, BLR-1 NLR and MDR15), a seven transmembrane, G-protein-coupled receptor, is the specific receptor for CXC chemokine, CXCL13/BLC/BCA-1. In peripheral blood, CXCR5 expression is restricted to B lymphocytes and a small subset of CD4+ and CD8+ lymphocytes. The restricted expression pattern of CXCR5 on B cells and follicular T helper cells (Tfh) suggests that this receptor functions as a regulator of B and T cell migration. Stimulation of T cells with anti-CD3 monoclonal antibody leads to the down-regulation of CXCR5.

940042 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940042 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940042" on CiteAb

Development References (6)

  1. Barella L, Loetscher M, Tobler A, Baggiolini M, Moser B. Sequence variation of a novel heptahelical leucocyte receptor through alternative transcript formation. Biochem J. 1995; 309(3):773-779. (Biology). View Reference
  2. Dobner T, Wolf I, Emrich T, Lipp M. Differentiation-specific expression of a novel G protein-coupled receptor from Burkitt's lymphoma. Eur J Immunol. 1992; 22(11):2795-2799. (Biology). View Reference
  3. Forster R, Emrich T, Kremmer E, Lipp M. Expression of the G-protein--coupled receptor BLR1 defines mature, recirculating B cells and a subset of T-helper memory cells. Blood. 1994; 84(3):830-840. (Immunogen: Flow cytometry, Immunohistochemistry). View Reference
  4. Gunn MD, Ngo VN, Ansel KM, Ekland EH, Cyster JG, Williams LT. A B-cell-homing chemokine made in lymphoid follicles activates Burkitt's lymphoma receptor-1. Nature. 1998; 391(6669):799-803. (Biology). View Reference
  5. Kouba M, Vanetti M, Wang X, Schafer M, Hollt V. Cloning of a novel putative G-protein-coupled receptor (NLR) which is expressed in neuronal and lymphatic tissue. FEBS Lett. 1993; 321(2-3):173-178. (Biology). View Reference
  6. Legler DF, Loetscher M, Roos RS, Clark-Lewis I, Baggiolini M, Moser B. B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5. J Exp Med. 1998; 187(4):655-660. (Biology). View Reference
View All (6) View Less
940042 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.