Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse DO-11.10 Clonotypic TCR

BD™ AbSeq Oligo Mouse Anti-Mouse DO-11.10 Clonotypic TCR

Clone KJ1-26 (RUO)

940479
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
DO-11.10 clonotypic TCR
2 µl
Mouse BALB.B x AKR IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAAGGTAAGGGTAGGGTTCTGAGCGGATATGGATTT
AMM2241
DO-11.10 T hybridoma cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940479 Rev. 2
Antibody Details
Down Arrow
KJ1-26

The KJ1-26 monoclonal antibody specifically reacts with the DO-11.10 Clonotypic T-cell Receptor (TCR) of the BALB/c-derived DO-11.10 T-cell hybridoma and T lymphocytes from the DO-11.10 transgenic mouse (TgN[DO-11.10]10Loh). The DO-11.10 TCR, an 80-90-kDa (non-reduced) or 40-44-kDa (reduced) protein, is specific for the chicken OVA(323-339)/I-A[d] complex. The DO-11.10 T-cell hybridoma also responds strongly to chicken OVA/I-A[b] and jungle fowl OVA/I-A[d] and weakly to turkey OVA/I-A[d] and I-A[b]. The DO-11.10 mouse model is valuable for studies of T-cell immigration, immunoregulation, development, activation, and function. The KJ1-26 mAb was shown to block the antigen responses of the DO-11.10 T-cell hybridoma in vitro.

940479 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940479 Rev.2
Citations & References
Down Arrow

Development References (7)

  1. Egan RM, Yorkey C, Black R, Loh WK, Stevens JL, Woodward JG. Peptide-specific T cell clonal expansion in vivo following immunization in the eye, an immune-privileged site. J Immunol. 1996; 157(6):2262-2271. (Biology). View Reference
  2. Garside P, Ingulli E, Merica RR, Johnson JG, Noelle RJ, Jenkins MK. Visualization of specific B and T lymphocyte interactions in the lymph node. Science. 1998; 281(5373):96-99. (Clone-specific: Immunohistochemistry). View Reference
  3. Haskins K, Kubo R, White J, Pigeon M, Kappler J, Marrack P. The major histocompatibility complex-restricted antigen receptor on T cells. I. Isolation with a monoclonal antibody. J Exp Med. 1983; 157(4):1149-1169. (Immunogen: Blocking, Immunoprecipitation, Inhibition, Neutralization, Radioimmunoassay). View Reference
  4. Jackson Laboratories. Jax® Mice and Services. Available: http://jaxmice.jax.org 2001, November.
  5. Lee WT, Cole-Calkins J, Street NE. Memory T cell development in the absence of specific antigen priming. J Immunol. 1996; 157(12):5300-5307. (Biology). View Reference
  6. Marrack P, Shimonkevitz R, Hannum C, Haskins K, Kappler J. The major histocompatibility complex-restricted antigen receptor on T cells. IV. An antiidiotypic antibody predicts both antigen and I-specificity. J Exp Med. 1983; 158(5):1635-1646. (Clone-specific: Blocking, ELISA, Immunoprecipitation). View Reference
  7. Murphy KM, Heimberger AB, Loh DY. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science. 1990; 250(4988):1720-1723. (Biology). View Reference
View All (7) View Less
940479 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.