Skip to main content Skip to navigation
Oligo Mouse Anti-Human TIM-3 (CD366)

BD™ AbSeq Oligo Mouse Anti-Human TIM-3 (CD366)

Clone 7D3

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD366; HAVCR2; TIM3; T cell immunoglobulin mucin-3; TIMD-3; KIM-3
84868
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGGTAGTAGTCCCGTATATCCGATCCGTGTTGTTT
AHS0016
Human TIM-3
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940066 Rev. 3
Antibody Details
Down Arrow Up Arrow
7D3

The 7D3 monoclonal antibody specifically binds to T cell immunoglobulin mucin 3 (TIM-3) which is also known as, CD366, or T-cell immunoglobulin and mucin domain-containing protein 3 (TIMD-3/TIMD3). CD366 is encoded by the HAVCR2 gene (Hepatitis A virus cellular receptor 2). CD366 is a type I transmembrane glycoprotein and belongs to the human TIM family (along with TIM-1 and TIM-4) within the immunoglobulin superfamily. CD366 is expressed on Th1, Tc1, Th17, Treg, NK T, and NK cells. CD366 is also expressed on dendritic cells, mast cells, monocytes, and macrophages. It is not expressed by Th2 and B cells. CD366 helps maintain peripheral immune tolerance and homeostasis. CD366 regulates macrophage activation and is a negative regulator of Th1 cell function. Crosslinking of cell surface CD366 by binding to Galectin-9 and/or phosphatidylserine appears to play an important role in either positively or negatively regulating leucocyte functions, such as cytokine production or the phagocytosis of apoptotic cells. CD366 may also be useful as an AML stem cell surface marker because it appears to be more highly expressed by AML leukemia stem cells than by normal bone marrow hematopoietic stem cells.

940066 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940066 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (12)

  1. Domenig C, Zheng XX, Sabatos CA, et al. Tim-3 inhibits T helper type 1-mediated auto- and alloimmune responses and promotes immunological tolerance. Nat Immunol. 2003; 4(11):1093-1101. (Biology). View Reference
  2. Freeman GJ, Casasnovas JM, Umetsu DT, DeKruyff RH. TIM genes: a family of cell surface phosphatidylserine receptors that regulate innate and adaptive immunity.. Immunol Rev. 2010; 235(1):172-89. (Biology). View Reference
  3. Hafler DA, Kuchroo V. TIMs: Central regulators of immune responses. J Exp Med. 2008; 205:2699-2701. (Biology). View Reference
  4. Jan M, Chao MP, Cha AC, et al. Prospective separation of normal and leukemic stem cells based on differential expression of TIM3, a human acute myeloid leukemia stem cell marker. Proc Natl Acad Sci U S A. 2011; 108(12):5009-5014. (Biology). View Reference
  5. Khademi M, Illes Z, Gielen AW, et al. T Cell Ig- and mucin-domain-containing molecule-3 (TIM-3) and TIM-1 molecules are differentially expressed on human Th1 and Th2 cells and in cerebrospinal fluid-derived mononuclear cells in multiple sclerosis. J Immunol. 2004; 172(11):7169-7176. (Biology). View Reference
  6. Lee J, Su EW, Zhu C, et al. Phosphotyrosine-dependent coupling of Tim-3 to T-cell receptor signaling pathways. Mol Cell Biol. 2011; 31(19):3963-3974. (Biology). View Reference
  7. Lee JS, Park MJ, Park S, Lee ES. Differential expression of T cell immunoglobulin- and mucin-domain-containing molecule-3 (TIM-3) according to activity of Behcet's disease. Br J Dermatol. 2012; 65(3):220-222. (Biology). View Reference
  8. Moorman JP, Wang JM, Zhang Y, et al. Tim-3 pathway controls regulatory and effector T cell balance during hepatitis C virus infection. J Immunol. 2012; 189(2):755-766. (Biology). View Reference
  9. Ndhlovu LC, Lopez-Verges S, Barbour JD, et al. Tim-3 marks human natural killer cell maturation and suppresses cell-mediated cytotoxicity. Blood. 2012; 119(16):3734-3743. (Biology). View Reference
  10. Rodriguez-Manzanet R, DeKruyff R, Kuchroo VK, Umetsu DT. The costimulatory role of TIM molecules. Immunol Rev. 2009; 229(1):259-270. (Biology). View Reference
  11. Wang F, Wan L, Zhang C, Zheng X, Li J, Chen ZK. Tim-3-Galectin-9 pathway involves the suppression induced by CD4+CD25+ regulatory T cells. Immunobiology. 2009; 214(5):342-349. (Biology). View Reference
  12. van de Weyer PS, Muehlfeit M, Klose C, Bonventre JV, Walz G, Kuehn EW. A highly conserved tyrosine of Tim-3 is phosphorylated upon stimulation by its ligand galectin-9. Biochem Biophys Res Commun. 2006; 351(2):571-576. (Biology). View Reference
View All (12) View Less
940066 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.