Skip to main content Skip to navigation
Oligo Mouse Anti-Human LAG-3 (CD223)

BD™ AbSeq Oligo Mouse Anti-Human LAG-3 (CD223)

Clone T47-530 (RUO)

940080
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
LAG3; CD223; FDC; Lymphocyte activation gene 3 protein; Protein FDC
3902
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGGCATGAATTAGGCGAGACTTAGTATACGAGCTGG
AHS0018
Human LAG-3 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940080 Rev. 3
Antibody Details
Down Arrow
T47-530

The T47-530 specifically recognizes the Lymphocyte Activation Gene 3 (LAG-3) protein which is also known as, Protein FDC, or CD223. LAG-3 is a ~70 kDa type I transmembrane glycoprotein that belongs to the Ig superfamily and exhibits homology to CD4. LAG-3 is expressed on NK cells, regulatory T cells, and activated conventional T cells with higher expression found on CD8+ T cells compared with CD4+ T cells. LAG-3 is an activation induced cell surface molecule that like CD4, binds MHC class II molecules, but with much higher affinity. This may enable LAG-3 to act as a negative competitor of CD4 for MHC class II ligand binding. LAG-3 may associate with the TCR-CD3 complex to downregulate TCR signal transduction and T cell clonal expansion. In contrast, LAG-3-induced signaling may promote dendritic cell activation.

940080 Rev. 3
Citations & References
Down Arrow

Development References (6)

  1. Casati C, Camisaschi C, Novellino L, et al. Human lymphocyte activation gene-3 molecules expressed by activated T cells deliver costimulation signal for dendritic cell activation. J Immunol. 2008; 180(6):3782-3788. (Biology). View Reference
  2. Hannier S, Tournier M, Bismuth G, Triebel F. CD3/TCR complex-associated lymphocyte activation gene-3 molecules inhibit CD3/TCR signaling. J Immunol. 1998; 161(8):4058-4065. (Biology). View Reference
  3. Huang CT, Workman CJ, Flies D, et al. Role of LAG-3 in regulatory T cells. Immunity. 2004; 21(4):503-513. (Biology). View Reference
  4. Moya R, Robertson HK, Payne D, Narsale A, Koziol J, Davies JD. A pilot study showing associations between frequency of CD4(+) memory cell subsets at diagnosis and duration of partial remission in type 1 diabetes.. Clin Immunol. 2016; 166-167:72-80. (Clone-specific: Flow cytometry). View Reference
  5. Triebel F, Hacene K, Pichon MF. A soluble lymphocyte activation gene-3 (sLAG-3) protein as a prognostic factor in human breast cancer expressing estrogen or progesterone receptors. Cancer Lett. 2006; 235(1):147-153. (Biology). View Reference
  6. Triebel F, Jitsukawa S, Baixeras E, et al. LAG-3, a novel lymphocyte activation gene closely related to CD4. J Exp Med. 1990; 171(5):1393-1405. (Biology). View Reference
View All (6) View Less
940080 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.