Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD83

BD™ AbSeq Oligo Mouse Anti-Human CD83

Clone HB15e (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
BL11; HB15; B-cell activation protein
9308
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGCTTGGACGATGGTATATTAACGATTGAGAGTGC
AHS0084
Human CD83 transfected COS cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940054 Rev. 3
Antibody Details
Down Arrow Up Arrow
HB15e

The HB15e monoclonal antibody specifically binds to a 45 kDa type 1 transmembrane glycoprotein member of the Ig superfamily. CD83 is composed of a single V-type Ig extracellular domain with a C-terminal cytoplasmic tail. Cell surface CD83 is expressed mainly by follicular dendritic cells, circulating dendritic cells, interdigitating dendritic cells in lymphoid tissues, in vitro-generated dendritic cells and thymic dendritic cells. However, its expression is not restricted to dendritic cells. CD83 is also expressed on some germinal center B cells and some lymphoblastoid cell lines. Although its function is not known, it may play a role in cell-cell interaction during antigen presentation.

940054 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940054 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940054" on CiteAb

Development References (6)

  1. Cao W, Lee SH, Lu J. CD83 is preformed inside monocytes, macrophages and dendritic cells, but it is only stably expressed on activated dendritic cells. Biochem J. 2005; 358(Pt 1):85-93. (Clone-specific: Flow cytometry). View Reference
  2. Hart DN. Dendritic cells: unique leukocyte populations which control the primary immune response. Blood. 1997; 90(9):3245-3287. (Biology). View Reference
  3. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  4. Tedder TF, Jansen PJ. CD83 Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:191-193.
  5. Zhou LJ, Tedder TF. CD14+ blood monocytes can differentiate into functionally mature CD83+ dendritic cells. Proc Natl Acad Sci U S A. 1996; 93(6):2588-2592. (Biology). View Reference
  6. Zhou LJ, Tedder TF. Human blood dendritic cells selectively express CD83, a member of the immunoglobulin superfamily. J Immunol. 1995; 154(8):3821-3835. (Biology). View Reference
View All (6) View Less
940054 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.