Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD8

BD™ AbSeq Oligo Mouse Anti-Human CD8

Clone RPA-T8

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD8α; CD8A; CD8 alpha; Leu2; MAL; T8; p32
925
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGATTGGGTACGCGCTTGGCTTATATAGTCGGGTCT
AHS0027
Human CD8a
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940003 Rev. 3
Antibody Details
Down Arrow Up Arrow
RPA-T8

The RPA-T8 monoclonal antibody specifically binds to CD8 alpha (CD8α). CD8α is a type I transmembrane glycoprotein and a member of the immunoglobulin superfamily. CD8α is expressed by the majority of thymocytes, by subpopulations of  αβ T cells and γδ T cells and by some NK cells. Cell surface CD8α is expressed either as a disulfide-linked homodimer (CD8αα) or as a heterodimer (CD8αβ) when disulfide-bonded to a CD8 beta chain (CD8β). CD8-positive αβ T cells coexpress both CD8αα homodimers and CD8αβ heterodimers whereas some γδ T cells and NK cells express CD8αα homodimers.  CD8 plays important roles in T cell activation and selection. The extracellular IgSF domain of CD8α binds to a non-polymorphic determinant on HLA class I molecules (α3 domain) and enables CD8 to function as a co-receptor with MHC class I-restricted TCR during T cell recognition of antigen. The cytoplasmic domain of CD8α associates with Lck, a Src family protein tyrosine kinase that is involved in intracellular signaling. The RPA-T8 and HIT8a monoclonal antibodies are not cross-blocking.  This clone has been reported to react with a subset of peripheral blood lymphocytes, but not monocytes nor granuloyctes, of baboon and both rhesus and cynomolgus macaque monkey. In general, a higher frequency of CD8+ and CD4+CD8+ lymphocytes are observed in non-human primates compared to normal human donors.

940003 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940003 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Garbrecht F, Loebel A, Disanto JP, Flomenberg N. Chatacterization of Workshop antiCD8 mAb using human CD8-expressing murine L-cell transfectants. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:354-356.
  2. Kersh EN, Kersh GJ, Allen PM. Partially phosphorylated T cell receptor zeta molecules can inhibit T cell activation. J Exp Med. 1999; 190(11):1627-1636. (Clone-specific: Flow cytometry). View Reference
  3. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  4. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  5. Rabin RL, Park MK, Liao F, Swofford R, Stephany D, Farber JM. Chemokine receptor responses on T cells are achieved through regulation of both receptor expression and signaling. J Immunol. 1999; 162(7):3840-3850. (Clone-specific: Flow cytometry). View Reference
  6. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  7. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (7) View Less
940003 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.