Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD5

BD™ AbSeq Oligo Mouse Anti-Human CD5

Clone UCHT2

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD5 antigen (p56-62); T1; Tp67; LEU1; Lymphocyte antigen T1/Leu-1
921
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ACGAAGCGAGCGAAGAACCTATGCGATTGAGTAAGT
AHS0047
Human T cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940038 Rev. 3
Antibody Details
Down Arrow Up Arrow
UCHT2

The UCHT2 monoclonal antibody specifically binds to CD5. CD5 is a 67 kDa single-chain, type 1 transmembrane glycoprotein expressed on most thymocytes, the majority of peripheral T lymphocytes and a subpopulation of B cells. CD72 has been shown to be the natural ligand for CD5. CD5+ B cells produce polyreactive antibodies (mostly IgM).

940038 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940038 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (8)

  1. Bernard A, Boumsell L, Dausset J, Milstein C, Schlossman SF, ed. Leukocyte Typing. New York: Springer-Verlag; 1984:1-814.
  2. Bernard A, Boumsell L, Hill C. Joint report of the first international workshop on human leucocyte differentiation antigens by the investigators of the participating laboratories: T2 protocol. In: Bernard A. A. Bernard .. et al., ed. Leucocyte typing : human leucocyte differentiation antigens detected by monoclonal antibodies : specification, classification, nomenclature = Typage leucocytaire : antigènes de différenciation leucocytaire humains révélés par les anticorps monoclonaux : "Rapports des études communes". Berlin New York: Springer-Verlag; 1984:25-60.
  3. In: Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007:49-50.
  4. Lankester AC, van Schijndel GM, Cordell JL, van Noesel CJ, van Lier RA. CD5 is associated with the human B cell antigen receptor complex. Eur J Immunol. 1994; 24(4):812-816. (Biology). View Reference
  5. Lydyard PM, Lamour A, MacKenzie LE, Jamin C, Mageed RA, Youinou P. CD5+ B cells and the immune system. Immunol Lett. 1993; 38(2):159-166. (Biology: Flow cytometry). View Reference
  6. McMichael AJ, Gotch FM. T-cell antigens: new and previously defined clusters. In: McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:31-62.
  7. McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:1-1050.
  8. Wallace DL, Beverley PC. Phenotypic changes associated with activation of CD45RA+ and CD45RO+ T cells. Immunology. 1990; 69(3):460-467. (Clone-specific: Flow cytometry). View Reference
View All (8) View Less
940038 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.