Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD279 (PD-1)

BD™ AbSeq Oligo Mouse Anti-Human CD279 (PD-1)

Clone EH12.1 (also known as EH12) (RUO)

940015
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
PD1; hPD-1; hPD-l; PDCD1; PDC1; Programmed cell death 1; SLEB2; hSLE1
5133
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATGGTAGTATCACGACGTAGTAGGGTAATTGGCAGT
AHS0014
Human PD-1 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940015 Rev. 3
Antibody Details
Down Arrow
EH12.1

The EH12.1 monoclonal antibody specifically binds to CD279 which is also known as Programmed cell death 1 (PD1). CD279 is an immunoregulatory receptor  expressed on activated T cells, B cells, and myeloid cells. It contains an immunoreceptor tyrosine-based inhibitory motif (ITIM) in the cytoplasmic region. Mice deficient in CD279 show a breakdown of peripheral tolerance and manifest multiple autoimmune symptoms. PD-L1 and PD-L2 are ligands of CD279 and members of the B7 gene family. CD279:PD-Ligands interaction inhibits T cell proliferation and cytokine secretion. Reports suggest that the B7/CTLA-4 pathway primarily attenuates, limits, and/or terminates naïve T-cell activation in secondary lymphoid organs. The PD-ligand:CD279 pathway, on the other hand, may primarily attenuate, limit, and/or terminate T-, B-, and myeloid cell activation/effector function at sites of inflammation in the periphery.

940015 Rev. 3
Citations & References
Down Arrow

Development References (8)

  1. Bennett F, Luxenberg D, Ling V, et al. Program death-1 engagement upon TCR activation has distinct effects on costimulation and cytokine-driven proliferation: attenuation of ICOS, IL-4, and IL-21, but not CD28, IL-7, and IL-15 responses. J Immunol. 2003; 170(2):711-718. (Biology). View Reference
  2. Carter L, Fouser LA, Jussif J, et al. PD-1:PD-L inhibitory pathway affects both CD4(+) and CD8(+) T cells and is overcome by IL-2. Eur J Immunol. 2002; 32:634-643. (Biology). View Reference
  3. Dorfman DM, Brown JA, Shahsafaei A, Freeman GJ. Programmed death-1 (PD-1) is a marker of germinal center-associated T cells and angioimmunoblastic T-cell lymphoma. Am J Surg Pathol. 2006; 30:802-810. (Immunogen: Flow cytometry, Immunohistochemistry). View Reference
  4. Freeman GJ, Long AJ, Iwai Y, et al. Engagement of PD-1 immunoinhibitory receptor by a novel B7 family member leads to negative regulation of lymphocyte activation. J Exp Med. 2000; 192:1027-1034. (Biology). View Reference
  5. Kanai T, Totsuka T, Uraushihara K, et al. Blockade of B7-H1 suppresses the development of chronic intestinal inflammation. J Immunol. 2003; 171(8):4156-4163. (Biology). View Reference
  6. Latchman Y, Wood CR, Chernova T, et al. PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2001; 2(3):261-268. (Biology). View Reference
  7. Nishimura H, Minato N, Nakano T, Honjo T. Immunological studies on PD-1 deficient mice: implication of PD-1 as a negative regulator for B cell responses. Int Immunol. 1998; 10(10):1563-1572. (Immunogen: Immunoprecipitation). View Reference
  8. Velu V, Kannanganat S, Ibegbu C, et al. Elevated expression levels of inhibitory receptor programmed death 1 on simian immunodeficiency virus-specific CD8 T cells during chronic infection but not after vaccination. J Virol. 2007; 81(11):5819-5828. (Clone-specific: Blocking, Flow cytometry, Functional assay, Inhibition). View Reference
View All (8) View Less
940015 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.