Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD278 (ICOS)

BD™ AbSeq Oligo Mouse Anti-Human CD278 (ICOS)

Clone DX29

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
ICOS; DX-29; H4; Inducible T-cell costimulator; AILIM; CVID1
29851
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATAGTCCGCCGTAATCGTTGTGTCGCTGAAAGGGTT
AHS0012
Activated human T cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940043 Rev. 3
Antibody Details
Down Arrow Up Arrow
DX29

The DX29 monoclonal antibody specifically binds to human CD278, which is also known as Inducible Costimulator (ICOS) or Inducible T-cell Costimulator. ICOS is a homodimeric type I transmembrane glycoprotein with an approximate molecular weight of 50-60 kDa. It is a member of the CD28 family and is highly expressed on activated T cells. CD278 is the receptor for ICOS-ligand (also known as, CD275, B7-H2, B7RP-1, or LICOS). Like CD28, ICOS can provide a costimulatory signal for T cell activation, proliferation and cytokine production. It is not expressed on resting or activated B cells, monocytes, NK cells, granulocytes, dendritic cells or platelets. Unlike the constitutively expressed CD28, ICOS is de novo expressed upon cellular activation. Reports describe similarities between CD28 and ICOS in T cell activation, such as the costimulation of cytokine production. However, it has been suggested that ICOS may play a greater role in IL-10 production. In the presence of IL-10, purified recombinant human ICOS protein significantly increased in vitro B cell growth stimulated by pokeweed mitogen (PWM) and enhanced production of IgG.

940043 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940043 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940043" on CiteAb

Development References (7)

  1. Aicher A, Hayden-Ledbetter M, Brady WA, et al. Characterization of human inducible costimulator ligand expression and function. J Immunol. 2000; 164(9):4689-4696. (Biology). View Reference
  2. Dong C, Nurieva RI. Regulation of immune and autoimmune responses by ICOS. J Autoimmun. 2003; 21(3):255-260. (Biology). View Reference
  3. Fos C, Salles A, Lang V, et al. ICOS ligation recruits the p50alpha PI3K regulatory subunit to the immunological synapse. J Immunol. 2008; 181(3):1969-1977. (Clone-specific: Flow cytometry). View Reference
  4. Kallinich T, Beier KC, Gelfand EW, Kroczek RA, Hamelmann E. Co-stimulatory molecules as potential targets for therapeutic intervention in allergic airway disease. Clin Exp Allergy. 2005; 35(12):1521-1534. (Biology). View Reference
  5. Okamoto N, Tezuka K, Kato M, Abe R, Tsuji T. PI3-kinase and MAP-kinase signaling cascades in AILIM/ICOS- and CD28-costimulated T-cells have distinct functions between cell proliferation and IL-10 production. Biochem Biophys Res Commun. 2003; 310(3):691-702. (Biology). View Reference
  6. Sakamoto S, Tezuka K, Tsuji T, Hori N, Tamatani T. AILIM/ICOS: its expression and functional analysis with monoclonal antibodies. Hybrid Hybridomics. 2001; 20(5-6):293-303. (Biology). View Reference
  7. Witsch EJ, Peiser M, Hutloff A, et al. ICOS and CD28 reversely regulate IL-10 on re-activation of human effector T cells with mature dendritic cells. Eur J Immunol. 2002; 32(9):2680-2686. (Biology). View Reference
View All (7) View Less
940043 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.