Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD235a/b

BD™ AbSeq Oligo Mouse Anti-Human CD235a/b

Clone GA-R2 (HIR2) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD235ab; CD235a, Glycophorin-A, GYPA, GPA; CD235b; Glycophorin-B, GYPB, GPB
2993, 2994
2 µl
Mouse IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTATGGCAGGCGAGCGATTGTACTAGGTTTCTTGT
AHS0048
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940040 Rev. 3
Antibody Details
Down Arrow Up Arrow
GA-R2 (HIR2)

The GA-R2 (also known as HIR2) monoclonal antibody specifically binds to CD235a and CD235b. CD235a is also known as Glycophorin A (GYPA, GPA, GLPA), Sialoglycoprotein alpha, MN sialoglycoprotein, or PAS-2. CD235b is otherwise known as Glycophorin B (GYPB, GPB, GLPB), Sialoglycoprotein delta, SS-active sialoglycoprotein, or PAS-3. CD235a and CD235b are type I transmembrane sialoglycoproteins that are expressed on human erythrocytes, erythroid precursor cells and certain leukemic cell types. CD235a carries blood group M and N antigens, whereas CD235b contains S, s, and U antigens. This antibody is useful for the identification and characterization of erythrocytes, certain myeloid leukemic cell types, and studies of erythroid cell development and infectious diseases with erythrocyte involvement. Glycophorins may play a role in preventing cell agglutination.

940040 Rev. 3
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940040 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940040" on CiteAb

Development References (7)

  1. Bain BJ. Leukemia diagnosis: A guide to the FAB classification. 1990.
  2. Blanchard D, Roux YP-L, Vusio P, Follea G. Characterization of monoclonal antibodies directed to human red blood cell glycophorins A and B. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:579-582.
  3. Gross S, Helm K, Gruntmeir JJ, Stillman WS, Pyatt DW, Irons RD. Characterization and phenotypic analysis of differentiating CD34+ human bone marrow cells in liquid culture. Br J Haematol. 1997; 5(318):326. (Clone-specific: Flow cytometry). View Reference
  4. Keren DF, Hanson CA, Hurtubise PE. David F. Keren, Curtis A. Hanson, Paul E. Hurtubise., ed. Flow cytometry and clinical diagnosis. Chicago: ASCP Press; 1994:1-676.
  5. Loken MR, Civin CI, Bigbee WL, Langlois RG, Jensen RH. Coordinate glycosylation and cell surface expression of glycophorin A during normal human erythropoiesis. Blood. 1987; 70(6):1959-1961. (Biology). View Reference
  6. Nakahata T, Okumura N. Cell surface antigen expression in human erythroid progenitors: erythroid and megakaryocytic markers. Leuk Lymphoma. 1994; 13(5-6):401-409. (Biology). View Reference
  7. Rogers CE, Bradley MS, Palsson BO, Koller MR. Flow cytometric analysis of human bone marrow perfusion cultures: erythroid development and relationship with burst-forming units-erythroid. Exp Hematol. 1996; 24(5):597-604. (Biology). View Reference
View All (7) View Less
940040 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.