Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD20

BD™ AbSeq Oligo Mouse Anti-Human CD20

Clone 2H7

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
MS4A1; B1; Bp35; LEU-16; S7
931
2 µl
Mouse C57BL/6 IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGCTTGTTGCGCGTTAGAGAGTATGTCGGGAGATG
AHS0008
Human 6.16c1.3 B cell line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940016 Rev. 3
Antibody Details
Down Arrow Up Arrow
2H7

The 2H7 monoclonal antibody specifically binds to CD20, encoded by the MS4A1 (Membrane-spanning 4-domains, subfamily A, member 1) gene. CD20 is a 33-37 kDa, unglycosylated four-transmembrane phosphoprotein. CD20 is expressed on pre-B-cells, resting and activated B cells, and follicular dendritic cells, but not plasma cells. Low level CD20 expression is observed on a small subset of normal circulating T lymphocytes. The CD20 molecule is involved in the regulation of B-cell activation.

940016 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940016 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Clark EA, Yokochi T. Human B cell and B cell blast-associated surface molecules defined with monoclonal antibodies. In: Bernard A, Boumsell L, Dausset J, Milstein C, Schlossman SF, ed. Leukocyte Typing. Berlin: Springer-Verlag; 1984:339-346.
  2. Hultin LE, Hausner MA, Hultin PM, Giorgi JV. CD20 (pan-B cell) antigen is expressed at a low level on a subpopulation of human T lymphocytes. Cytometry. 1993; 14(2):193-204. (Clone-specific: Flow cytometry). View Reference
  3. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  4. Ledbetter JA, Clark EA. Surface phenotype and function of tonsillar germinal center and mantle zone B cell subsets. Hum Immunol. 1986; 15:30-43. (Immunogen: Blocking, Flow cytometry). View Reference
  5. Loken MR, Shah VO, Dattilio KL, Civin CI. Flow cytometric analysis of human bone marrow. II. Normal B lymphocyte development. Blood. 1987; 70(5):1316-1324. (Biology). View Reference
  6. Reinherz EL. Ellis L. Reinherz .. et al., ed. Leukocyte typing II. New York: Springer-Verlag; 1986:1-560.
  7. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
View All (7) View Less
940016 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.