Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD195

BD™ AbSeq Oligo Mouse Anti-Human CD195

Clone 2D7/CCR5

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CCR5; C-C chemokine receptor type 5; CC-CKR-5; CKR5; CHEMR13
1234
2 µl
Mouse C57BL/6 IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATGGTTTAGTCGTACGTGGGTTTAGATTGGCGGTGC
AHS0070
Human CCR5 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940050 Rev. 3
Antibody Details
Down Arrow Up Arrow
2D7/CCR5

The 2D7/CCR5 monoclonal antibody specifically binds to the human chemokine receptor CCR5, also known as CD195. CCR5 is a seven transmembrane-spanning G protein-associated molecule that belongs to the beta chemokine receptor family and expressed on a subset of T lymphocytes (CD3+CD45RO+CD95+). CCR5 regulates lymphocyte chemotaxis activation and transendothelial migration during inflammation by signaling a response to at least three chemokines: Regulated upon Activation Normal T-cell Expressed and Secreted (RANTES), Macrophage Inflammatory Protein-1 (MIP-1), and Monocyte Chemoattractant Protein 2 (MCP-2).  Additionally, CCR5 has been found to be a coreceptor for macrophage-tropic HIV-1 on CD4+ cells, a characteristic that is important in viral transmission. Reports indicate that individuals who have partial (heterozygous) or complete (homozygous) deletion of the CCR5 allele demonstrate resistance to HIV infection. This antibody has been shown to block ligand and gp120 binding. It is also able to neutralize HIV infection.  

940050 Rev. 3
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940050 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (10)

  1. Choe H, Farzan M, Sun Y, et al. The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell. 1996; 85(7):1135-1148. (Biology). View Reference
  2. Dambra PP, Loria MP, D'Oronzio L, et al. The Cytokine Receptor Panel: Flow cytometry analysis on lymphocytes from neonates, young, aged normal donors, and from patients with HIV infection or AIDS. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:269-271.
  3. Deng H, Liu R, Ellmeier W, et al. Identification of a major co-receptor for primary isolates of HIV-1. Nature. 1996; 381(6584):661-666. (Biology). View Reference
  4. Doranz BJ, Rucker J, Yi Y, et al. A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell. 1996; 85(7):1149-1158. (Biology). View Reference
  5. Dragic T, Litwin V, Allaway GP, et al. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature. 1996; 381(6584):667-673. (Biology). View Reference
  6. Hancock WW. Chemokines and the pathogenesis of T cell-dependent immune responses. Am J Pathol. 1996; 148(3):681-684. (Biology). View Reference
  7. Raport CJ, Gosling J, Schweickart VL, Gray PW, Charo IF. Molecular cloning and functional characterization of a novel human CC chemokine receptor (CCR5) for RANTES, MIP-1beta, and MIP-1alpha. J Biol Chem. 1996; 271(29):17161-17166. (Biology). View Reference
  8. Uguccioni M, Willimann K. Cytokine/Chemokine Receptors: Section report. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:237-243.
  9. Wu L, LaRosa G, Kassam N, et al. Interaction of chemokine receptor CCR5 with its ligands: multiple domains for HIV-1 gp120 binding and a single domain for chemokine binding. J Exp Med. 1997; 186(8):1373-1381. (Immunogen: Blocking, Flow cytometry, Inhibition). View Reference
  10. Wu L, Paxton WA, Kassam N, et al. CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro. J Exp Med. 1997; 185(9):1681-1689. (Biology). View Reference
View All (10) View Less
940050 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.