Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD183 (CXCR3)

BD™ AbSeq Oligo Mouse Anti-Human CD183 (CXCR3)

Clone 1C6/CXCR3 (also known as 1C6, LS177-1C6)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CXCR3; C-X-C chemokine receptor type 3; GPR9; IP10R; MigR; CKRL2; CMKAR3
2833
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAAGTGTTGGCGTTATGTGTTCGTTAGCGGTGTGGG
AHS0031
Human CXCR3 Peptide
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940030 Rev. 3
Antibody Details
Down Arrow Up Arrow
1C6/CXCR3

The 1C6/CXCR3 monoclonal antibody specifically binds to human CD183, also known as the CXCR3 chemokine receptor. CD183 is a 40-41 kDa seven-transmembrane protein and member of the G protein-coupled receptor family. CD183 is expressed primarily on activated T cells that infiltrate inflammatory sites. It has also been detected on some circulating T cells, B cells, and NK cells. Reports show that some CXCR3-positive T cells also express CCR5 and are mostly CD45RO-positive cells. Three ligands for CXCR3 have been identified. They are CXCL9 (Mig/monokine induced by interferon-γ), CXCL10 (IP-10/interferon-γ inducible 10-kD protein), and CXCL11 (I-TAC/interferon-inducible T-cell alpha chemoattractant). These chemokines are produced by a variety of cells upon stimulation by IFN-γ and interact with CXCR3 to mediate T-cell chemotaxis. This reagent has been reported to be suitable for immunohistochemical staining of acetone-fixed, frozen sections and/or formalin-fixed, paraffin-embedded tissue sections with citrate pretreatment. Clone 1C6/CXCR3 also cross reacts with a subset of peripheral blood lymphocytes of baboon, and both rhesus and cynomolgus macaque monkeys. The distribution of lymphocytes is similar to that observed with CD183-positive peripheral blood lymphocytes from normal human donors. CXCR3 has been clustered as CD183 in the VIIth HLDA workshop.  

940030 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940030 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Loetscher M, Gerber B, Loetscher P, et al. Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes. J Exp Med. 1996; 184(3):963-969. (Biology). View Reference
  2. Marcher C, Moller BK, Lillevang ST, Kristensen T. CXCR4 and IL17R are downregulated on cord-blood CD34-positive cells during short-term culture. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:629-632.
  3. Piali L, Weber C, LaRosa G, et al. The chemokine receptor CXCR3 mediates rapid and shear-resistant adhesion-induction of effector T lymphocytes by the chemokines IP10 and Mig. Eur J Immunol. 1998; 28(3):961-972. (Biology). View Reference
  4. Qin S, Rottman JB, Myers P, et al. The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions. J Clin Invest. 1998; 101(4):746-754. (Immunogen: Blocking, Flow cytometry, Immunohistochemistry, Inhibition). View Reference
  5. Uguccioni M, Willimann K. Cytokine/Chemokine Receptors: Section report. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:237-243.
940030 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.