Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD154

BD™ AbSeq Oligo Mouse Anti-Human CD154

Clone TRAP1 (also known as TRAP-1) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD40LG; CD40 ligand; CD40L; TNFSF5; T-BAM; TRAP
959
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAAGAGGTAAGTGCATTCGGGTATAGGCGTGATTTG
AHS0077
Human TRAP1 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940053 Rev. 3
Antibody Details
Down Arrow Up Arrow
TRAP1

The TRAP1 monoclonal antibody specifically binds to CD154. CD154 is a 39 kDa type II membrane glycoprotein that is a member of the tumor necrosis factor superfamily, Tumor necrosis factor ligand superfamily member 5 (TNFSF5). CD154 is expressed on a variety of cell types including activated CD4+ T cells and some CD8+ T cells, NK cells, mast cells and basophils. CD154 is also known as CD40 ligand (CD40L); it serves as a ligand for CD40 that is expressed on B cells, macrophages, and dendritic cells.  The expression of CD154 by activated T-helper cells costimulates B-cell activation and proliferation through binding to CD40 expressed on B cells. In response to T-dependent antigens, the CD154 and CD40 interaction is required for B-lymphocyte differentiation, including immunoglobulin production and isotype switching and memory B cell generation. The TRAP1 antibody can partially block T cell-B cell interaction and inhibit the subsequent proliferation, differentiation, and memory formation of B cells. It has been reported that patients with X-linked hyper-IgM syndrome have defective expression of functional CD154 due to mutations in the CD40LG gene that encodes CD154.

940053 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940053 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940053" on CiteAb

Development References (10)

  1. Altenburg A, Baldus SE, Smola H, Pfister H, Hess S. CD40 ligand-CD40 interaction induces chemokines in cervical carcinoma cells in synergism with IFN-gamma. J Immunol. 1999; 162(7):4140-4147. (Clone-specific: Immunohistochemistry). View Reference
  2. Fuleihan R, Ramesh N, Horner A, et al. Cyclosporin A inhibits CD40 ligand expression in T lymphocytes. J Clin Invest. 1994; 93(3):1315-1320. (Biology). View Reference
  3. Gray D, Dullforce P, Jainandunsing S. Memory B cell development but not germinal center formation is impaired by in vivo blockade of CD40-CD40 ligand interaction. J Exp Med. 1994; 180(1):141-155. (Biology). View Reference
  4. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  5. Kroczek RA, Graf D, Brugnoni D, et al. Defective expression of CD40 ligand on T cells causes "X-linked immunodeficiency with hyper-IgM (HIGM1)". Immunol Rev. 1994; 138:39-59. (Clone-specific: Flow cytometry). View Reference
  6. MacDonald KP, Nishioka Y, Lipsky PE, Thomas R. Functional CD40 ligand is expressed by T cells in rheumatoid arthritis. J Clin Invest. 1997; 100(9):2404-2414. (Clone-specific: Flow cytometry). View Reference
  7. Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002.
  8. Nishioka Y, Lipsky PE. The role of CD40-CD40 ligand interaction in human T cell-B cell collaboration. J Immunol. 1994; 153(3):1027-1036. (Biology). View Reference
  9. O'Gorman MR, Zaas D, Paniagua M, Corrochano V, Scholl PR, Pachman LM. Development of a rapid whole blood flow cytometry procedure for the diagnosis of X-linked hyper-IgM syndrome patients and carriers. Clin Immunol Immunopathol. 1997; 85(2):172-181. (Biology: Flow cytometry). View Reference
  10. van Kooten C, Gaillard C, Galizzi JP, et al. B cells regulate expression of CD40 ligand on activated T cells by lowering the mRNA level and through the release of soluble CD40. Eur J Immunol. 1994; 24(4):787-792. (Biology). View Reference
View All (10) View Less
940053 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.