Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD127

BD™ AbSeq Oligo Mouse Anti-Human CD127

Clone HIL-7R-M21 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
IL-7R; IL7R; IL7RA; IL-7Rα; IL-7R-alpha; Interleukin-7 Receptor alpha
3575
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTTATTAGGCTCGTAGGTATGTTTAGGTTATCGCG
AHS0028
Human IL-7R Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940012 Rev. 3
Antibody Details
Down Arrow Up Arrow
HIL-7R-M21

The hIL-7R-M21 monoclonal antibody specifically binds to the 60-90 kDa glycoprotein, CD127. CD127 is also known as the IL-7 receptor alpha (IL-7Rα) subunit. The IL-7 receptor complex is a heterodimer composed of CD127 and the common gamma chain (γc, CD132), shared by other cytokine receptors (IL-2R, IL-4R, IL-9R, IL-15R, and IL-21R). CD127 is expressed on thymocytes, T- and B-cell progenitors, mature T cells, and some lymphoid and myeloid cells. In vitro experiments show the expression of CD127 is down-regulated following T cell activation. Studies indicate that the IL-7 Receptor plays an important role in the proliferation and differentiation of mature T cells.  Recently, it has been shown that low surface expression of CD127, in combination with intermediate to high surface expression of CD25, the α chain of the IL-2 receptor complex, can distinguish between human regulatory and conventional CD4+ T cells in human adult and cord blood, lymph nodes and thymus.

940012 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940012 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940012" on CiteAb

Development References (7)

  1. Appasamy PM. Biological and clinical implications of interleukin-7 and lymphopoiesis. Cytokines Cell Mol Ther. 1999; 5(1):25-39. (Biology: Flow cytometry). View Reference
  2. Armitage RJ, Ziegler SF, Friend DJ, Park LS, Fanslow WC. Identification of a novel low-affinity receptor for human interleukin-7. Blood. 1992; 79(7):1738-1745. (Immunogen: Flow cytometry). View Reference
  3. Benjamin D, Sharma V, Knobloch TJ, Armitage RJ, Dayton MA, Goodwin RG. B cell IL-7. Human B cell lines constitutively secrete IL-7 and express IL-7 receptors. J Immunol. 1994; 152(10):4749-4757. (Clone-specific: Flow cytometry). View Reference
  4. Goodwin RG, Friend D, Ziegler SF et al. Cloning of the human and murine interleukin-7 receptors: demonstration of a soluble form and homology to a new receptor superfamily. Cell. 1990; 60(6):941-951. (Biology). View Reference
  5. Hofmeister R, Khaled AR, Benbernou N, Rajnavolgyi E, Muegge K, Durum SK. Interleukin-7: physiological roles and mechanisms of action. Cytokine Growth Factor Rev. 1999; 10(1):41-60. (Biology). View Reference
  6. Liu W, Putnam AL, Xu-Yu Z, et al. CD127 expression inversely correlates with FoxP3 and suppressive function of human CD4+ T reg cells. J Exp Med. 2006; 203(7):1701-1711. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  7. Seddiki N, Santner-Nanan B, Martinson J et al. Expression of interleukin (IL)-2 and IL-7 receptors discriminates between human regulatory and activated T cells. J Exp Med. 2006; 203(7):1693-1700. (Biology). View Reference
View All (7) View Less
940012 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.