Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD90.2

BD™ AbSeq Oligo Rat Anti-Mouse CD90.2

Clone 30-H12 (RUO)

Sign In
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Thy-1.2; T25; Thymus Cell Antigen 1; Theta
21838
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTCCGTGGTGGGTAAGTTATCGAGAGCATTCATTTG
AMM2140
Mouse Thymus / Spleen
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940344 Rev. 2
Antibody Details
Down Arrow
30-H12

The 30-H12 monoclonal antibody specifically binds to CD90.2 (Thy-1.2) alloantigen on thymocytes, most peripheral T lymphocytes, some intraepithelial T lymphocytes (IEL, DEC), epithelial cells, fibroblasts, neurons, hematopoietic stem cells, but not B lymphocytes, of most mouse strains. Thy-1.2 has also been initially reported to be detectable on thymic dendritic cells, but later revealed that the antigen was probably picked up from T-lineage cells. 30-H12 mAb has been reported not to cross-react with Thy-1.1 (e.g., AKR/J, PL), or with rat Thy-1. CD90 is a GPI-anchored membrane glycoprotein of the Ig superfamily which is involved in signal transduction. In addition, there is evidence that CD90 mediates adhesion of thymocytes to thymic stroma. It has been reported that crosslinked 30-H12 antibody induces Ca2+ influx into thymocytes and that co-crosslinking of 30-H12 mAb with antibody to the CD3/TCR complex intensifies thymocyte signal transduction, promotes apoptosis of thymocytes, and inhibits the CD3-mediated proliferative response of mature T lymphocytes.

940344 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940344 Rev.2
Citations & References
Down Arrow

Development References (1)

  1. Nakashima I, Zhang YH, Rahman SM, et al. Evidence of synergy between Thy-1 and CD3/TCR complex in signal delivery to murine thymocytes for cell death. J Immunol. 1991; 147(4):1153-1162. (Biology: Apoptosis). View Reference
940344 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.