Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse CD45.2

BD™ AbSeq Oligo Mouse Anti-Mouse CD45.2

Clone 104 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ly-5.2; T200; LCA; Leukocyte common antigen; Ptprc
19264
2 µl
Mouse SJL IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGTAACGTAGCTCGGGAATAAGTAATGCGGAAGTC
AMM2014
B10.S mouse thymocytes and splenocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940118 Rev. 2
Antibody Details
Down Arrow Up Arrow
104

The 104 monoclonal antibody recognizes the CD45 (Leukocyte Common Antigen) present on all leucocytes of most mouse strains (eg, A, AKR, BALB/c, CBA/Ca, CBA/J, C3H/He, C57BL, C57BR, C57L, C58, DBA/1, DBA/2, NZB, SWR, 129). This alloantigen was originally named Ly-5.1, and this was the designation at the time that the antibody was characterized. The designation was later changed from Ly-5.1 to Ly-5.2 to conform with the convention that the .2 alloantigen designations be assigned to the C57BL/6 strain. mAb 104 has been reported not to react with leucocytes of the mouse strains expressing the CD45.1 alloantigen (eg, RIII, SJL/J, STS/A, and DA). CD45 is a member of the Protein Tyrosine Phosphatase (PTP) family: its intracellular (COOH-terminal) region contains two PTP catalytic domains, and the extracellular region is highly variable due to alternative splicing of exons 4, 5, and 6 (designated A, B, and C, respectively), plus differing levels of glycosylation. The CD45 isoforms detected in the mouse are cell type-, maturation-, and activation state-specific. The CD45 isoforms play complex roles in T-cell and B-cell antigen receptor signal transduction. The 104 antibody has been reported to inhibit some responses of B cells, from mice expressing the CD45.2 alloantigen, to certain antigens and LPS.  In addition, reduction of serum IgG levels and amelioration of autoimmune renal pathology were reported in mAb 104-treated systemic lupus erythematosus-prone mice.

940118 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940118 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940118" on CiteAb

Development References (9)

  1. Johnson P, Greenbaum L, Bottomly K, Trowbridge IS. Identification of the alternatively spliced exons of murine CD45 (T200) required for reactivity with B220 and other T200-restricted antibodies. J Exp Med. 1989; 169(3):1179-1184. (Biology). View Reference
  2. Morse HC 3rd, Shen FW, Hammerling U. Genetic nomenclature for loci controlling mouse lymphocyte antigens. Immunogenetics. 1987; 25(2):71-78. (Biology). View Reference
  3. Ogimoto M, Mizuno K, Tate G, et al. Regulation of lipopolysaccharide- and IL-4-induced immunoglobulin heavy chain gene activation: differential roles for CD45 and Lyb-2. Int Immunol. 1992; 4(6):651-659. (Biology). View Reference
  4. Shen FW, Tung JS, Boyse EA. Further definition of the Ly-5 system. Immunogenetics. 1986; 24(3):146-149. (Biology). View Reference
  5. Shen FW. Monoclonal antibodies to mouse lymphocyte differentiation alloantigens. In: Hammerling GJ, Hammerling U, Kearney JF, ed. Monoclonal Antibodies and T-cell Hybridomas; Perspectives and Technical Advances. 1981:25-31.
  6. Yakura H, Ashida T, Kawabata I, Katagiri M. Alleviation of autoimmunity in BXSB mice by monoclonal alloantibody to Ly-5 (CD45). Eur J Immunol. 1989; 19(8):1505-1508. (Clone-specific: Inhibition, In vivo exacerbation). View Reference
  7. Yakura H, Kawabata I, Ashida T, Katagiri M. Differential regulation by Ly-5 and Lyb-2 of IgG production induced by lipopolysaccharide and B cell stimulatory factor-1 (IL-4). J Immunol. 1988; 141(3):875-880. (Clone-specific: Inhibition). View Reference
  8. Yakura H, Kawabata I, Shen FW, Katagiri M. Selective inhibition of lipopolysaccharide-induced polyclonal IgG response by monoclonal Ly-5 antibody. J Immunol. 1986; 136(8):2729-2733. (Clone-specific: Inhibition). View Reference
  9. Yakura H, Shen FW, Bourcet E, Boyse EA. On the function of Ly-5 in the regulation of antigen-driven B cell differentiation. Comparison and contrast with Lyb-2. J Exp Med. 1983; 157(4):1077-1088. (Clone-specific: Inhibition). View Reference
View All (9) View Less
940118 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.