Skip to main content Skip to navigation
Oligo Mouse Anti-Human TCR Vα24-Jα18 (iNKT cell)

BD™ AbSeq Oligo Mouse Anti-Human TCR Vα24-Jα18 (iNKT cell)

Clone 6B11

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Vα24JαQ TCR Chain
2 µl
Mouse C57BL/6 IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTCTGGTTCGGTTGAGCTACTAATTTCGTTGGATGG
AHS0175
Peptide from CDR3 loop of the invariant TCR V24 sequence
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940506 Rev. 2
Antibody Details
Down Arrow Up Arrow
6B11

Monoclonal antibody 6B11 reacts with a unique determinant in the CDR3 region of the invariant (Vα24-JαQ) TCR chain. Thus 6B11 identifies a subset of all Vα24 positive T cells. The binding of the PE-conjugate of 6B11 can be partially blocked by other antibodies specific for Vα24 (BD Biosciences Pharmingen, data not shown). This invariant chain is expressed on invariant NK T cells, which are a small subset of T lymphocytes that also express other NK cell molecules such as CD161. Invariant NK T cells have been reported to play an immunoregulatory role. The Vα24-JαQ interacts with the CD1d protein. Invariant NK T cells can be specifically activated by CD1d-presented antigen resulting in rapid production of IL-4 and IFN (also known as IFN-γ). Studies of NK T cells describe their role in anti-tumor immunity and autoimmunity.

940506 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940506 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Exley MA, Tahir SM, Cheng O, et al. A major fraction of human bone marrow lymphocytes are Th2-like CD1d-reactive T cells that can suppress mixed lymphocyte responses. J Immunol. 2001; 167(10):5531-5534. (Biology). View Reference
  2. Illes Z, Kondo T, Newcombe J, Oka N, Tabira T, Yamamura T. Differential expression of NK T cell V alpha 24J alpha Q invariant TCR chain in the lesions of multiple sclerosis and chronic inflammatory demyelinating polyneuropathy. J Immunol. 2000; 164(8):4375-4381. (Biology). View Reference
  3. Kukreja A, Cost G, Marker J, et al. Multiple immuno-regulatory defects in type-1 diabetes. J Clin Invest. 2002; 109(1):131-140. (Immunogen: ELISA, Flow cytometry, Immunofluorescence). View Reference
  4. Tahir SM, Cheng O, Shaulov A, et al. Loss of IFN-gamma production by invariant NK T cells in advanced cancer. J Immunol. 2001; 167(7):4046-4050. (Clone-specific: Flow cytometry). View Reference
  5. Thomas SY, Hou R, Boyson JE, et al. CD1d-restricted NKT cells express a chemokine receptor profile indicative of Th1-type inflammatory homing cells. J Immunol. 2003; 171(5):2571-2580. (Clone-specific: Flow cytometry). View Reference
940506 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.