Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD38

BD™ AbSeq Oligo Mouse Anti-Human CD38

Clone HB7 (also known as HB-7) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
T10; ADP-ribosyl cyclase 1; Cyclic ADP-ribose hydrolase 1; OKT10
952
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGTAGGCACGGGATCGACGCATTAATTATAGTTGTT
AHS0189
Human BJAB B cell line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940466 Rev. 2
Antibody Details
Down Arrow Up Arrow
HB7

The HB7 monoclonal antibody specifically binds to human CD38. CD38 is a type II transmembrane glycoprotein of 45 kDa with a protein core of 35 kDa. The CD38 antigen is expressed on essentially all pre-B lymphocytes, plasma cells, and thymocytes. It is also present on activated T lymphocytes, natural killer (NK) lymphocytes, myeloblasts, and erythroblasts. The antigen is expressed during the early stages of T- and B-lymphocyte differentiation, is lost during the intermediate stages of maturation, and then reappears during the final stages of maturation. The CD38 antigen is expressed on 90% of CD34+ cells, and is not expressed on pluripotent stem cells. Coexpression of CD38 antigen on CD34+ cells indicates lineage commitment of those cells. CD38 is a counter-receptor of CD31. It is also expressed in T- and B-acute lymphoblastic leukemia (ALL), Burkitt's lymphoma, multiple myeloma, acute myeloid leukemia (AML), and chronic lymphocytic leukemia (CLL).

940466 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940466 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940466" on CiteAb

Development References (13)

  1. Deaglio S, Morra M, Mallone R, et al. Human CD38 (ADP-ribosyl cyclase) is a counter-receptor of CD31, an Ig superfamily member. J Immunol. 1998; 160(1):395-402. (Biology). View Reference
  2. Dörken B, Möller P, Pezzutto A, Schwartz-Albiez R, Moldenhauer G. B-cell antigens: CD38. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:86.
  3. Ghia P, Guida G, Stella S, et al. The pattern of CD38 expression defines a distinct subset of chronic lymphocytic leukemia (CLL) patients at risk of disease progression. Blood. 2003; 101(4):1262-1269. (Clone-specific: Flow cytometry). View Reference
  4. Giorgi JV. Lymphocyte subset measurements: significance in clinical medicine. In: Rose NR, Friedman H, Fahey JL, ed. Manual of Clinical Laboratory Immunology. 3rd ed.. Washington, DC: American Society for Microbiology; 1986:236-246.
  5. Landay A, Ohlsson-Wilhelm B, Giorgi JV. Application of flow cytometry to the study of HIV infection. AIDS. 1990; 4(6):479-497. (Biology). View Reference
  6. Pezzutto A, Behm F, Callard RE. Flow cytometry analysis of the B-cell blind panel: joint report. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:165-174.
  7. Reinherz EL, Kung PC, Goldstein G, Levey RH, Schlossman SF. Discrete stages of human intrathymic differentiation: analysis of normal thymocytes and leukemic lymphoblasts of T-cell lineage. Proc Natl Acad Sci U S A. 1980; 77(3):1588-1592. (Biology). View Reference
  8. Salazar-Gonzalez JF, Moody DJ, Giorgi JV, Martinez-Maza O, Mitsuyasu RT, Fahey JL. Reduced ecto-5'-nucleotidase activity and enhanced OKT10 and HLA-DR expression on CD8 (T suppressor/cytotoxic) lymphocytes in the acquired immune deficiency syndrome: evidence of CD8 cell immaturity. J Immunol. 1985; 135(3):1778-1785. (Biology). View Reference
  9. Tedder TF, Clement LT, Cooper MD. Discontinuous expression of a membrane antigen (HB-7) during B lymphocyte differentiation. Tissue Antigens. 1984; 24(3):140-149. (Immunogen: Flow cytometry, Fluorescence microscopy, Immunofluorescence, Immunoprecipitation). View Reference
  10. Tedder TF, Crain MJ, Kubagawa H, Clement LT, Cooper MD. Evaluation of lymphocyte differentiation in primary and secondary immunodeficiency diseases. J Immunol. 1985; 135(3):1785-1791. (Clone-specific: Immunofluorescence). View Reference
  11. Terstappen LW, Hollander Z, Meiners H, Loken MR. Quantitative comparison of myeloid antigens on five lineages of mature peripheral blood cells. J Leukoc Biol. 1990; 48(2):138-148. (Biology). View Reference
  12. Terstappen LW, Huang S, Picker LJ. Flow cytometric assessment of human T-cell differentiation in thymus and bone marrow. Blood. 1992; 79(3):666-677. (Biology). View Reference
  13. Terstappen LW, Huang S, Safford M, Lansdorp PM, Loken MR. Sequential generations of hematopoietic colonies derived from single nonlineage-committed CD34+CD38- progenitor cells. Blood. 1991; 77(6):1218-1227. (Biology). View Reference
View All (13) View Less
940466 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.