Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse CD90/Mouse CD90.1

BD™ AbSeq Oligo Mouse Anti-Mouse CD90/Mouse CD90.1

Clone HIS51 (RUO)

341032
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Thy-1/Thy-1.1
24832
2 µl
Mouse BALB/c IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAGTTGCCGGATTAGAGAAGTACGATAGAAAGAAGT
AMM2044
Rat bone marrow cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
  8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).

Data Sheets

940148 Rev. 1
Antibody Details
Down Arrow
HIS51

The HIS51 monoclonal antibody specifically binds to the rat Thy-1 antigen (CD90) expressed by hematopoietic stem cells, early myeloid and erythroid cells, immature B lymphocytes in the bone marrow and peripheral lymphoid organs, thymocytes, recent thymic emigrants (a subset of CD45RC- peripheral T cells), neurons, glomerular mesangial cells, endothelium at inflammatory sites, mast cells, and bone marrow-derived dendritic cells. Rat dendritic epidermal T cells (DEC) are Thy-1-negative. CD90 is a GPI-anchored membrane glycoprotein of the Ig superfamily which is involved in signal transduction. In addition, there is evidence in the mouse that CD90 mediates adhesion of thymocytes to thymic stroma. HIS51 antibody cross-reacts with the mouse Thy-1.1 alloantigen of the AKR/J and PL strains, but not Thy-1.2 found on most strains. In the mouse, CD90 is found on thymocytes, most peripheral T lymphocytes, some intraepithelial T lymphocytes (IEL, DEC), hematopoietic stem cells, and neurons, but not B lymphocytes.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940148 Rev. 1
Format Details
Down Arrow
Antibody-Oligo
Antibody-Oligo
940148 Rev.1
Citations & References
Down Arrow

Development References (12)

  1. Campbell DG, Gagnon J, Reid KB, Williams AF. Rat brain Thy-1 glycoprotein. The amino acid sequence, disulphide bonds and an unusual hydrophobic region. Biochem J. 1981; 195(1):15-30. (Biology). View Reference
  2. Chen-Woan M, Delaney CP, Fournier V, et al. In vitro characterization of rat bone marrow-derived dendritic cells and their precursors. J Leukoc Biol. 1996; 59(2):196-207. (Biology). View Reference
  3. Dráberová L, Amoui M, and Dráber P. Thy-1-mediated activation of rat mast cells: the role of Thy-1 membrane microdomains. Immunology. 1996; 87(1):141-148. (Biology). View Reference
  4. Elbe A, Kilgus O, Hünig T, and Stingl G. T-cell receptor diversity in dendritic epidermal T cells in the rat. J Invest Dermatol. 1993; 102:74-79. (Biology). View Reference
  5. Groen H, Klatter FA, van Petersen AS, Pater JM, Nieuwenhuis P, Kampinga J. Composition of rat CD4+ resting memory T-cell pool is influenced by major histocompatibility complex. Transplant Proc. 1993; 25(5):2782-2783. (Biology). View Reference
  6. He HT, Naquet P, Caillol D, Pierres M. Thy-1 supports adhesion of mouse thymocytes to thymic epithelial cells through a Ca2(+)-independent mechanism. J Exp Med. 1991; 173(2):515-518. (Biology). View Reference
  7. Hermans MH, Opstelten D. In situ visualization of hemopoietic cell subsets and stromal elements in rat and mouse bone marrow by immunostaining of frozen sections. J Histochem Cytochem. 1991; 39(12):1627-1634. (Immunogen). View Reference
  8. Hosseinzadeh H, Goldschneider I. Recent thymic emigrants in the rat express a unique antigenic phenotype and undergo post-thymic maturation in peripheral lymphoid tissues. J Immunol. 1993; 150(5):1670-1679. (Biology). View Reference
  9. Ishizu A, Ishikura H, Nakamaru Y et al. Thy-1 induced on rat endothelium regulates vascular permeability at sites of inflammation. Int Immunol. 1995; 7:1939-1947. (Biology). View Reference
  10. Kroese FG, de Boer NK, de Boer T, Nieuwenhuis P, Kantor AB, Deenen GJ. Identification and kinetics of two recently bone marrow-derived B cell populations in peripheral lymphoid tissues. Cell Immunol. 1995; 162(2):185-193. (Biology). View Reference
  11. Nakashima I, Pu M-Y, Hamaguchi M, et al. Pathway of signal delivery to murine thymocytes triggered by co-crosslinking CD3 and Thy-1 for cellular DNA fragmentation and growth inhibition. J Immunol. 1993; 151(7):3511-3520. (Biology).
  12. Paul LC, Rennke HG, Milford EL, and Carpenter CB. Thy-1.1 in glomeruli of rat kidneys. Kidney Int. 1984; 25:771-777. (Biology). View Reference
View All (12) View Less
940148 Rev. 1

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.