Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse CD64

BD™ AbSeq Oligo Mouse Anti-Mouse CD64

Clone X54-5/7.1 (also known as X54-5/7.1) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Fcgr1; FcRI; Fcg1; Fc-gamma RI; Fc receptor IgG high affinity I; IGGHAFC
14129
2 µl
Mouse NOD/Lt IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTAGGTATTATTGCGGTGTTGGCGACTTCTTTGGT
AMM2062
Mouse CD64 a Alloantigen
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940166 Rev. 2
Antibody Details
Down Arrow Up Arrow
X54-5/7.1

The X54-5/7.1 monoclonal antibody specifically recognizes FcγRI (CD64) encoded by the more common Fcgr1a and Fcgr1b alleles.  The alloantigens generated by the Fcgr1a and Fcgr1b alleles, have been confirmed positive in mouse strains BALB/c and C57BL/6 and reported positive in strains 129, A, AKR, ALR, BUB, C3H, C57BL/10, C57BLKS, C57BR, C58, CBA, CE, DBA/2, HRS, MRL, NON, NZB, NZO, NZW, PL, SJL, ST, SWR.  The a and b alloantigens have been reported negative in mouse strains ABH, NOD.  CD64, a key receptor in the development of immune responses, has a dual role as a low affinity receptor for IgG3 and high affinity receptor for IgG2a linking innate and adaptive immunities.  CD64 mediates endocytosis, phagocytosis, antibody-dependent cellular toxicity, cytokine release and superoxide generation.  CD64 is expressed largely on macrophages and dendritic cells.  For more information regarding clone X54-5/7.1 and the alloantigens it recognizes, please refer to the reference by Tan et al listed below. 

940166 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940166 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940166" on CiteAb

Development References (2)

  1. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  2. Tan PS, Gavin AL, Barnes N, et al. Unique monoclonal antibodies define expression of Fc gamma RI on macrophages and mast cell lines and demonstrate heterogeneity among subcutaneous and other dendritic cells. J Immunol. 2003; 170(5):2549-2556. (Clone-specific). View Reference
940166 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.