North America
South America
Australia & New Zealand
Europe
Middle East / Africa
Asia / Pacific
×
×
BD Logo
Oligo Rat Anti-Mouse CD8b RUO

Oligo Rat Anti-Mouse CD8b 

Clone  H35-17.2   (RUO)

  • Brand BD™ AbSeq
  • Alternative Name Ly-3; Lyt-3; Lymphocyte antigen 3; Ly-C; CD8b1
  • Entrez Gene ID 12526
  • Vol. Per Test 2 µl
  • Isotype Rat IgG2b, κ
  • Reactivity Mouse (Tested in Development) 
  • Application Single Cell 3' Sequencing (Qualified) 
  • Barcode Sequence TTTCGGGCGGTTATAGTATTAGTTGAGTCCAGCATC
  • Sequence ID AMM2189
  • Immunogen 5-day MLR, C57BL/6 anti-BALB/c
  • Storage Buffer Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
  • Regulatory Status RUO
Product Details Recommended Assay References

Description

The H35-17.2 monoclonal antibody specifically binds to both alloantigeneic forms of the β chain of the CD8 differentiation antigen (Ly-3 or Lyt- 3). The CD8 α and α' chains (CD8a) form heterodimers with the CD8 β chain (CD8b, Ly-3, or Lyt-3) on the surface of most thymocytes. A subpopulation of mature T lymphocytes (i.e., MHC class I-restricted T cells, including most T suppressor/cytotoxic cells) expresses almost exclusively the CD8 αβ heterodimer (the α' chain is absent). Subsets of γδ TCR-bearing T cells, intestinal intraepithelial lymphocytes, and dendritic cells express CD8a without CD8b. It has been suggested that the expression of the CD8a/CD8b heterodimer is restricted to T lymphocytes which matured in the thymus or in an extrathymic environment that had been influenced by thymus- initiated neuroendocrine signals. CD8 is an antigen coreceptor on the T-cell surface which interacts with MHC class I molecules on antigen-presenting cells. It participates in T-cell activation through its association with the T-cell receptor complex and protein tyrosine kinase lck (p56lck). The H35-17.2 mAb blocks T-cell-mediated cytolysis of allogeneic lymphoma cells.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

Format
  • Format Antibody-Oligo
Suggested Companion Products

Stain Buffer (FBS) RUO
500 mL Cat No: 554656

Single-Cell Analysis System RUO
1 Each Cat No: 633701

Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) 2.4G2 RUO
0.1 mg Cat No: 553141

Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) 2.4G2 RUO
0.5 mg Cat No: 553142

Resources & Tools
 Spectrum Viewer  Regulatory Document Website  Download TDS
Preparation and Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Please refer to bd.com/genomics-resources for technical protocols.


Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.


  1. Bierer BE, Sleckman BP, Ratnofsky SE, Burakoff SJ. The biologic roles of CD2, CD4, and CD8 in T-cell activation. Annu Rev Immunol. 1989; 7:579-599. View reference

  2. Fujiura Y, Kawaguchi M, Kondo Y, et al. Development of CD8 alpha alpha+ intestinal intraepithelial T cells in beta 2-microglobulin- and/or TAP1-deficient mice. J Immunol. 1996; 156(8):2710-2715. View reference

  3. Golstein P, Goridis C, Schmitt-Verhulst AM . Lymphoid cell surface interaction structures detected using cytolysis-inhibiting monoclonal antibodies. Immunol Rev. 1982; 68:5-42. View reference

  4. Janeway CA Jr. The T cell receptor as a multicomponent signalling machine: CD4/CD8 coreceptors and CD45 in T cell activation. Annu Rev Immunol. 1992; 10:645-674. View reference

  5. Ledbetter JA, Rouse RV, Micklem HS, Herzenberg LA. T cell subsets defined by expression of Lyt-1,2,3 and Thy-1 antigens. Two-parameter immunofluorescence and cytotoxicity analysis with monoclonal antibodies modifies current views. J Exp Med. 1980; 152(2):280-295. View reference

  6. Ledbetter JA, Seaman WE, Tsu TT, Herzenberg LA. Lyt-2 and Lyt-3 antigens are on two different polypeptide subunits linked by disulfide bonds. Relationship of subunits to T cell cytolytic activity. J Exp Med. 1981; 153:1503-1516.

  7. LeFrancois L. Extrathymic differentiation of intraepithelial lymphocytes: generation of a separate and unequal T-cell repertoire. Immunol Today. 1991; 12(12):436-438. View reference

  8. Lefrancois L. Phenotypic complexity of intraepithelial lymphocytes of the small intestine. J Immunol. 1991; 147(6):1746-1751. View reference

  9. MacDonald HR, Schreyer M, Howe RC, Bron C. Selective expression of CD8 alpha (Ly-2) subunit on activated thymic gamma/delta cells. Eur J Immunol. 1990; 20(4):927-930. View reference

  10. Murosaki S, Yoshikai Y, Ishida A, et al. Failure of T cell receptor V beta negative selection in murine intestinal intra-epithelial lymphocytes. Int Immunol. 1991; 3(10):1005-1013. View reference

  11. Nakayama K, Nakayama K, Negishi I, et al. Requirement for CD8 beta chain in positive selection of CD8-lineage T cells. Science. 1994; 263(5150):1131-1133. View reference

  12. O'Rourke AM, Mescher MF. The roles of CD8 in cytotoxic T lymphocyte function. Immunol Today. 1993; 14(4):183-188. View reference

  13. Rocha B, Vassalli P, Guy-Grand D. The extrathymic T-cell development pathway. Immunol Today. 1992; 14(3):140-141. View reference

  14. Sydora BC, Brossay L, Hagenbaugh A, Kronenberg M, Cheroutre H. TAP-independent selection of CD8+ intestinal intraepithelial lymphocytes. J Immunol. 1996; 156(11):4209-4216. View reference

  15. Süss G, Shortman K. A subclass of dendritic cells kills CD4 T cells via Fas/Fas-ligand-induced apoptosis. J Exp Med. 1996; 183(4):1789-1796. View reference

  16. Vremec D, Zorbas M, Scollay R, et al. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J Exp Med. 1992; 176(1):47-58. View reference

  17. Walker ID, Murray BJ, Hogarth PM, Kelso A, McKenzie IF. Comparison of thymic and peripheral T cell Ly-2/3 antigens. Eur J Immunol. 1984; 14(10):906-910. View reference

  18. Wang J, Klein JR. Thymus-neuroendocrine interactions in extrathymic T cell development. Science. 1994; 265(5180):1860-1862. View reference

  19. Wu L, Vremec D, Ardavin C, et al. Mouse thymus dendritic cells: kinetics of development and changes in surface markers during maturation. Eur J Immunol. 1995; 25(2):418-425. View reference

  20. Zamoyska R. The CD8 coreceptor revisited: one chain good, two chains better. Immunity. 1994; 1(4):243-246. View reference

940360 Rev. 1
Instruments
Reagents
Applications
Sales & Support
BD BioSciences