Oligo Rat Anti-Mouse Integrin ß7 Chain
Clone M293 (RUO)
- Brand BD™ AbSeq
- Alternative Name Itgb7; Integrin βp; Integrin beta-P; Integrin beta-7; Ly69; M290 IEL Ag
- Entrez Gene ID 16421
- Vol. Per Test 2 µl
- Isotype Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
- Reactivity Mouse (Tested in Development)
- Application
Single Cell 3' Sequencing (Qualified)
- Barcode Sequence GGATGTCAAGGCGAATTATGTACTAGTGTGTCAAGG
- Sequence ID AMM2071
- Immunogen αIELβ7 integrin from the C57BL/10 mouse T-cell hybridoma MTC-1
- Storage Buffer Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
- Regulatory Status RUO
Regulatory Status Legend
Description
The M293 monoclonal antibody specifically recognizes the integrin ß7 chain (also known as integrin ßp), which is found in association with either of two α chains. α4ß7 (LPAM-1) is expressed on most mature lymphocytes and on small subsets of thymic and bone marrow cells; it interacts with several ligands, including VCAM-1, fibronectin, and MAdCAM-1. αIELß7 is found primarily on intestinal mucosal and intraepithelial lymphocytes (IEL), and it may be primarily involved in interactions between IEL and epithelia via recognition of E-cadherin. The epitope recognized by the mAb M293 has been mapped to the region between amino acids 387 and 542. The M293 antibody exhibits little or no activity in blocking ß7 integrin-mediated adhesion.
Application Notes
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.
NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.
Format
- Format Antibody-Oligo
Suggested Companion Products
Single-Cell Analysis System RUO
1 Each
Cat No: 633701
Stain Buffer (FBS) RUO
500 mL
Cat No: 554656
Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) 2.4G2 RUO
0.1 mg
Cat No: 553141
Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) 2.4G2 RUO
0.5 mg
Cat No: 553142
Resources & Tools | ||||||
---|---|---|---|---|---|---|
Spectrum Viewer | Regulatory Document Website | Download TDS |
Preparation and Storage
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze.
The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.
Product Notices
- This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
- The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
- Please refer to bd.com/genomics-resources for technical protocols.
- Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
- Source of all serum proteins is from USDA inspected abattoirs located in the United States.
- This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
- Illumina is a trademark of Illumina, Inc.
- Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.
BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.