Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD11a

BD™ AbSeq Oligo Mouse Anti-Human CD11a

Clone HI111

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
LFA-1α; Lymphocyte (Leukocyte) function-associated antigen 1 α chain; ITGAL
3683
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGTAGAGTAGTCGATTGTTTGATGCGCCAGATGTC
AHS0081
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940077 Rev. 3
Antibody Details
Down Arrow Up Arrow
HI111

The HI111 monoclonal antibody specifically binds to CD11a, the 180 kDa integrin α chain. This type I transmembrane glycoprotein associates with CD18 (integrin β2) to form the heterodimeric glycoprotein CD11a/CD18. This heterodimer is also known as the lymphocyte (leukocytes) function associated antigen-1 (LFA-1) that is expressed on all leukocytes. LFA-1 is an adhesion molecule involved in lymphocyte and granulocyte functions. LFA-1 mediates adhesion of lymphoid cells to the vascular endothelium in association with its ligand, and the intracellular adhesion molecule-1 (ICAM-1), CD54. Other ligands are ICAM-2 (CD102) and ICAM-3 (CD50).

940077 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940077 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (11)

  1. Bochner BS, Luscinskas FW, Gimbrone MA Jr, et al. Adhesion of human basophils, eosinophils, and neutrophils to interleukin 1-activated human vascular endothelial cells: contributions of endothelial cell adhesion molecules. J Exp Med. 1991; 173(6):1553-1557. (Biology). View Reference
  2. Diamond MS, Staunton DE, de Fougerolles AR, et al. ICAM-1 (CD54): a counter-receptor for Mac-1 (CD11b/CD18). J Cell Biol. 1990; 111(6):3129-3139. (Biology). View Reference
  3. Dustin ML, Springer TA. Lymphocyte function-associated antigen-1 (LFA-1) interaction with intercellular adhesion molecule-1 (ICAM-1) is one of at least three mechanisms for lymphocyte adhesion to cultured endothelial cells. J Cell Biol. 1988; 107(1):321-331. (Biology). View Reference
  4. Inghirami G, Wieczorek R, Zhu BY, Silber R, Dalla-Favera R, Knowles DM. Differential expression of LFA-1 molecules in non-Hodgkin's lymphoma and lymphoid leukemia. Blood. 1988; 72(4):1431-1434. (Biology). View Reference
  5. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  6. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  7. Ma Q, Shimaoka M, Lu C, Jing H, Carman CV, Springer TA. Activation-induced conformational changes in the I domain region of lymphocyte function-associated antigen 1. J Biol Chem. 2002; 277(12):10638-10641. (Clone-specific: Flow cytometry, Functional assay). View Reference
  8. Rothlein R, Dustin ML, Marlin SD, Springer TA. A human intercellular adhesion molecule (ICAM-1) distinct from LFA-1. J Immunol. 1986; 137(4):1270-1274. (Biology). View Reference
  9. Schnitzler N, Haase G, Podbielski A, Lutticken R, Schweizer KG. A co-stimulatory signal through ICAM-beta2 integrin-binding potentiates neutrophil phagocytosis. Nat Med. 1999; 5(2):231-235. (Biology). View Reference
  10. Vallhonrat H, Williams WW, Cosimi AB, et al. In vivo generation of C4d, Bb, iC3b, and SC5b-9 after OKT3 administration in kidney and lung transplant recipients. Transplantation. 1999; 67(2):253-258. (Biology). View Reference
  11. Yawalkar N, Hunger RE, Pichler WJ, Braathen LR, Brand CU. Human afferent lymph from normal skin contains an increased number of mainly memory / effector CD4(+) T cells expressing activation, adhesion and co-stimulatory molecules. Eur J Immunol. 2000; 30(2):491-497. (Clone-specific: Flow cytometry). View Reference
View All (11) View Less
940077 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.