Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD155

Oligo Rat Anti-Mouse CD155

Clone 3F1

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Poliovirus receptor; Pvr; Tumor-associated antigen 1; Taa1; Tage4; HVED
52118
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ACCTTCGGGAGTAACGTAGATAATGTAATAGTCAGC
AMM2169
Mouse CD155 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Please refer to bd.com/genomics-resources for technical protocols.
940359 Rev. 1
Antibody Details
Down Arrow Up Arrow
3F1

The 3F1 monoclonal antibody specifically binds to CD155, which is also known as Poliovirus receptor (Pvr) or Tumor-associated antigen 1 (Taa1). CD155 is a type I transmembrane glycoprotein that belongs to the Ig supergene family. CD155 is an adhesion receptor that binds to different ligands including nectin-3, CD96, CD226, TIGIT, and the extracellular matrix protein vitronectin. It is highly expressed on double positive thymocytes and variably expressed on mature thymocytes and T cells, including regulatory T cells and NKT cells. CD155 is also differentially expressed on subsets of B cells, plasma cells, dendritic cells, and monocytes. CD155 expression is upregulated by activated T cells, B cells, and dendritic cells. CD155 is involved in forming adherens junctions between adjacent epithelial or endothelial cells. CD155 plays roles in regulating cell growth, adhesion, motility, migration, and cell-mediated cytotoxicity. CD155-deficient mice exhibit impaired secondary humoral immune responses to orally administered antigens.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940359 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms. NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.
Antibody-Oligo
940359 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (3)

  1. Danisch S, Qiu Q, Seth S, et al. CD226 interaction with CD155 impacts on retention and negative selection of CD8 positive thymocytes as well as T cell differentiation to follicular helper cells in Peyer's Patches.. Immunobiology. 2013; 218(2):152-8. (Biology). View Reference
  2. Maier MK, Seth S, Czeloth N, et al. The adhesion receptor CD155 determines the magnitude of humoral immune responses against orally ingested antigens.. Eur J Immunol. 2007; 37(8):2214-25. (Immunogen: ELISA, Flow cytometry). View Reference
  3. Stanietsky N, Rovis TL, Glasner A, et al. Mouse TIGIT inhibits NK-cell cytotoxicity upon interaction with PVR.. Eur J Immunol. 2013; 43(8):2138-50. (Clone-specific: Flow cytometry). View Reference
940359 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.