Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD81

BD™ AbSeq Oligo Hamster Anti-Mouse CD81

Clone Eat2 (RUO)

940439
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
TAPA-1; Tspan28; Tapa1; Tapa-1; Target of the antiproliferative antibody 1
12520, 25621
2 µl
Armenian Hamster IgG, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAGAGATTAGTGGTTCGGTGTTTGGTTATTCGTAGC
AMM2199
CD81+ mouse B lymphoma 38C13
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940439 Rev. 2
Antibody Details
Down Arrow
Eat2

The Eat2 monoclonal antibody specifically binds to CD81, a 26-kDa nonglycosylated member of the transmembrane 4 integral membrane protein superfamily, expressed by many types of cells.  For example, CD81 participates with CD19 and CD21 in the signal  transduction complex associated with the B-cell receptor on human B lymphocytes and with the CD4 and CD8 co-receptors on human thymocytes and T lymphocytes.  In mouse fetal thymic organ culture, interactions of immature thymocytes with CD81 expressed by thymic stromal cells are required to induce development of T cells with αβ T-cell receptors.  Furthermore, CD81 has been shown to play a role in the regulation of rat mastcell degranulation.  Despite its important roles in the immune response and wide tissue distribution, CD81-deficient mice are born without obvious developmental abnormalities.  However, these mice have abnormal immune responses, and impaired fertility.  Eat2 mAb cross-reacts with the rat CD81 antigen.

940439 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940439 Rev.2
Citations & References
Down Arrow

Development References (10)

  1. Boismenu R, Rhein M, Fischer WH, Havran WL. A role for CD81 in early T cell development. Science. 1996; 271(5246):198-200. (Biology). View Reference
  2. Deng J, Yeung VP, Tsitoura D, DeKruyff RH, Umetsu DT, Levy S. Allergen-induced airway hyperreactivity is diminished in CD81-deficient mice. J Immunol. 2000; 165(9):5054-5061. (Biology). View Reference
  3. Fleming TJ, Donnadieu E, Song CH, Laethem FV, Galli SJ, Kinet JP. Negative regulation of Fc epsilon RI-mediated degranulation by CD81. J Exp Med. 1997; 186(8):1307-1314. (Biology). View Reference
  4. Levy S, Todd SC, Maecker HT. CD81 (TAPA-1): a molecule involved in signal transduction and cell adhesion in the immune system. Annu Rev Immunol. 1998; 16:89-109. (Biology). View Reference
  5. Maecker HT, Do MS, Levy S. Maecker HT, Do MS, Levy S. Proc Natl Acad Sci U S A. 1998; 95(5):2458-2462. (Biology). View Reference
  6. Maecker HT, Levy S. Normal lymphocyte development but delayed humoral immune response in CD81-null mice. J Exp Med. 1997; 185(8):1505-1510. (Biology). View Reference
  7. Maecker HT, Todd SC, Kim EC, Levy S. Differential expression of murine CD81 highlighted by new anti-mouse CD81 monoclonal antibodies. Hybridoma. 2000; 19(1):15-22. (Immunogen). View Reference
  8. Miyazaki T, Müller U, Campbell KS. Normal development but differentially altered proliferative responses of lymphocytes in mice lacking CD81. EMBO J. 1997; 16(14):4217-4225. (Biology). View Reference
  9. Tedder TF, Zhou LJ, Engel P. The CD19/CD21 signal transduction complex of B lymphocytes. Immunol Today. 1994; 15(9):437-442. (Biology). View Reference
  10. Tsitsikov EN, Gutierrez-Ramos JC, Geha RS. Impaired CD19 expression and signaling, enhanced antibody response to type II T independent antigen and reduction of B-1 cells in CD81-deficient mice. Proc Natl Acad Sci U S A. 1997; 94(20):10844-10849. (Biology). View Reference
View All (10) View Less
940439 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.